Previous Contig 012645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024P24Sequence637004517 (4)gb:AE016959_10228743e-60Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01521012645 (2)
JMSF029F21Sequence619004517 (4)gb:AE016959_10228741e-52Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01174012645 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024P24+ CNGTNAGAAATTGGNTNAGAAATGGCNAGNGAAGCCGGGGNAAC
                      ____________________________________________________________
consensus CNGTNAGAAATTGGNTNAGAAATGGCNAGNGAAGCCGGGGNAAC
 
. : . : . : . : . : . :
rJMSF024P24+ CGGCGGNGAAGNCTTTTGAAAGCNAGNGAAAACGGGNAGCNGCTTTTNTTNCCCCCGNGG
                      ____________________________________________________________
consensus CGGCGGNGAAGNCTTTTGAAAGCNAGNGAAAACGGGNAGCNGCTTTTNTTNCCCCCGNGG
 
. : . : . : . : . : . :
rJMSF024P24+ NACCTGCNAGNCNGAATNCTGGTGGNGCTGGNGNCGNCCNAAATGATGTAGNGGCNATAA
                      ____________________________________________________________
consensus NACCTGCNAGNCNGAATNCTGGTGGNGCTGGNGNCGNCCNAAATGATGTAGNGGCNATAA
 
. : . : . : . : . : . :
rJMSF024P24+ CTGTGTNTTTGAAGNGAAAGGCNAAGGAATTTGGNCNGCNAAAATTTNAGGNGAAGNTTG
                      ____________________________________________________________
consensus CTGTGTNTTTGAAGNGAAAGGCNAAGGAATTTGGNCNGCNAAAATTTNAGGNGAAGNTTG
 
. : . : . : . : . : . :
rJMSF024P24+ ATGCNGAAGAATNCCTTGCNGCNTTTGCTGGNAAGCCTNAAAAGNAGNAATTTNAGNCCC
                      ____________________________________________________________
consensus ATGCNGAAGAATNCCTTGCNGCNTTTGCTGGNAAGCCTNAAAAGNAGNAATTTNAGNCCC
 
. : . : . : . : . : . :
rJMSF024P24+ CCTNGTTTCNGTTGGTAACTTGCCGTGTTNGTGAATCAAAGNGNTNCCNACNTGNTCCCN
                      ____________________________________________________________
consensus CCTNGTTTCNGTTGGTAACTTGCCGTGTTNGTGAATCAAAGNGNTNCCNACNTGNTCCCN
 
. : . : . : . : . : . :
rJMSF024P24+ CTNTCCTTNTGGTTCNAATGCTTTTGNGNGTCCTNCGGNGGGNTTNGGCNGTTGGGCCCN
rJMSF029F21+ GTTGGGCCCN
                      ____________________________________________________________
consensus CTNTCCTTNTGGTTCNAATGCTTTTGNGNGTCCTNCGGNGGGNTTNGGCNGTTGGGCCCN
 
. : . : . : . : . : . :
rJMSF024P24+ ATTTTTTTTCCTGATNTTGTGTGNGNCGTTGCCCNANTTTTAGTCTTTCTTTTTTCATCT
rJMSF029F21+ ATTTTTTTTCCTGNTNTTGNGNGNGNCGTTGCCCNATTTTTAGTNTTTNTTTTTTCNTCT
                      ____________________________________________________________
consensus ATTTTTTTTCCTGATNTTGTGTGNGNCGTTGCCCNATTTTTAGTCTTTCTTTTTTCATCT
 
. : . : . : . : . : . :
rJMSF024P24+ NTTCCGNATCCAAAACCCAAAACCAAAAAAAAAACAAAAACAAAAAAAAGGACTACC
rJMSF029F21+ TTTCNGNATCNAAAACCCAAAACCAAAAAAAAAACAAAAACAAAAAAAAGGACTACCAAC
                      ____________________________________________________________
consensus TTTCCGNATCCAAAACCCAAAACCAAAAAAAAAACAAAAACAAAAAAAAGGACTACCAAC