Previous Contig 012642:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029E16Sequence701012642 (2)780012642 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029E16- GACTGCGATTAAGCAACCTTTCATTCTCATCTTCTC
                      ____________________________________________________________
consensus GACTGCGATTAAGCAACCTTTCATTCTCATCTTCTC
 
. : . : . : . : . : . :
JMSF029E16- ATTATCGCAGCCTTTGCCTCTTTCTGCTGCAAAGAAATCTTATGATTATTGTTTATTTCT
                      ____________________________________________________________
consensus ATTATCGCAGCCTTTGCCTCTTTCTGCTGCAAAGAAATCTTATGATTATTGTTTATTTCT
 
. : . : . : . : . : . :
JMSF029E16- TTCATTAACATCCTATGTGGTTTCACCCACCAACCATTTTTTTCTTAATTTCTGTTCGAG
                      ____________________________________________________________
consensus TTCATTAACATCCTATGTGGTTTCACCCACCAACCATTTTTTTCTTAATTTCTGTTCGAG
 
. : . : . : . : . : . :
JMSF029E16- GTTTATATATGTGCATGTTTGAGTGTGGTGTAATAAAAATTATAAAAAGAAAAAAGAAGA
                      ____________________________________________________________
consensus GTTTATATATGTGCATGTTTGAGTGTGGTGTAATAAAAATTATAAAAAGAAAAAAGAAGA
 
. : . : . : . : . : . :
JMSF029E16- GAGCTTTCTTCAGTCCAAACATGGGTGGCAGTAGGATTCAATTAGCTTCCGACTCATTCA
                      ____________________________________________________________
consensus GAGCTTTCTTCAGTCCAAACATGGGTGGCAGTAGGATTCAATTAGCTTCCGACTCATTCA
 
. : . : . : . : . : . :
JMSF029E16- TCCAAATGCTGAGATGAGATGACGATGAACCCGGCCTTGATGACTAATGAACACTGTCTC
rJMSF029E16+ TCCAAATGCTGAGATGAGATGACGATGAACCCGGCCNTGATGACTAATGAACACTGTCTC
                      ____________________________________________________________
consensus TCCAAATGCTGAGATGAGATGACGATGAACCCGGCCTTGATGACTAATGAACACTGTCTC
 
. : . : . : . : . : . :
JMSF029E16- AGTAACTGAGTGAATGATGCGGGAGACAAGTTGGATCTTAAGCTTCCTGTACTTGGACTG
rJMSF029E16+ AGTAACTGAGTGAATGATGCGGGAGACAAGTTGGATCTTAAGCTTCCTGTACTTGGACTG
                      ____________________________________________________________
consensus AGTAACTGAGTGAATGATGCGGGAGACAAGTTGGATCTTAAGCTTCCTGTACTTGGACTG
 
. : . : . : . : . : . :
JMSF029E16- AAGGGAGCTCCCTTTTTAACCTTTAATTTTATTTTTCTGTTTATTGCACTTATTTTTACC
rJMSF029E16+ AAGGGAGCTCCCTTTTTAACCTTTAATTTTATTTTTCTGTTTATTGCACTTATTTTTACC
                      ____________________________________________________________
consensus AAGGGAGCTCCCTTTTTAACCTTTAATTTTATTTTTCTGTTTATTGCACTTATTTTTACC
 
. : . : . : . : . : . :
JMSF029E16- TTTAATATCTGTCTCTTTGCTAAGTTTCTGCAGATTCTTTGTTCCCTTTTCCACACTAAT
rJMSF029E16+ TTTAATATCTGTCTCTTTGCTAAGTTTCTGCAGATTCTTTGTTCCCTTTTCCACACTAAT
                      ____________________________________________________________
consensus TTTAATATCTGTCTCTTTGCTAAGTTTCTGCAGATTCTTTGTTCCCTTTTCCACACTAAT
 
. : . : . : . : . : . :
JMSF029E16- CGATCTGCCCAGCCAGATTCTATTTGGTTTGGTTTAATTTGTTGGTGTTTGCCAGTTACA
rJMSF029E16+ CGATCTGCCCAGCCAGATTCTATTTGGTTTGGTTTAATTTGTTGGTGTTTGCCAGTTACA
                      ____________________________________________________________
consensus CGATCTGCCCAGCCAGATTCTATTTGGTTTGGTTTAATTTGTTGGTGTTTGCCAGTTACA
 
. : . : . : . : . : . :
JMSF029E16- TATATAAATACACACATATACGTATAATTAAGTTTCAATTATTTCTGCATATTAATCTTG
rJMSF029E16+ TATATAAATACACACATATACGTATAATTAAGTTTCAATTATTTCTGCATATTAATCTTG
                      ____________________________________________________________
consensus TATATAAATACACACATATACGTATAATTAAGTTTCAATTATTTCTGCATATTAATCTTG
 
. : . : . : . : . : . :
JMSF029E16- AAGGCTGGAGAAAGGGTTTTTCATTGGTTAAAATNAGGGTTTTCGCCATTACTTATGCGG
rJMSF029E16+ AAGGCTGGAGAAAGGGTTTTTCATTGGTTAAAATTAGGGTTTTCGCCATTACTTATGCGG
                      ____________________________________________________________
consensus AAGGCTGGAGAAAGGGTTTTTCATTGGTTAAAATTAGGGTTTTCGCCATTACTTATGCGG
 
. : . : . : . : . : . :
JMSF029E16- TTGAA
rJMSF029E16+ TTGAAACTCATATTTGTTTAGTTTTACTGCCGTAATATATGCTGTTTGGCTATCTTGTTT
                      ____________________________________________________________
consensus TTGAAACTCATATTTGTTTAGTTTTACTGCCGTAATATATGCTGTTTGGCTATCTTGTTT
 
. : . : . : . : . : . :
rJMSF029E16+ TCAAAGCAGTTTATAGTTGACGACAAGAACGGATCTTGGCTAAGGTTTCGCGAGCAGGGA
                      ____________________________________________________________
consensus TCAAAGCAGTTTATAGTTGACGACAAGAACGGATCTTGGCTAAGGTTTCGCGAGCAGGGA
 
. : . : . : . : . : . :
rJMSF029E16+ GGAGCAGAAAAGGATTGGAACGCTTAACCGGCAAATTAAAGAAACCAAACGCTCAACGAC
                      ____________________________________________________________
consensus GGAGCAGAAAAGGATTGGAACGCTTAACCGGCAAATTAAAGAAACCAAACGCTCAACGAC
 
. : . : . : . : . : . :
rJMSF029E16+ AACGTCTCCATTCCTGGGCGCTGTTATCGTTGTTTGAACAAGTTCATATGACATTTGTCT
                      ____________________________________________________________
consensus AACGTCTCCATTCCTGGGCGCTGTTATCGTTGTTTGAACAAGTTCATATGACATTTGTCT
 
. : . : . : . : . : . :
rJMSF029E16+ TCACTGCTGCAGCGGCAACCTAAGTATCATCAATTTAACAATGTTATCAATGGCTAAGCA
                      ____________________________________________________________
consensus TCACTGCTGCAGCGGCAACCTAAGTATCATCAATTTAACAATGTTATCAATGGCTAAGCA
 
. : . : . : . : . : . :
rJMSF029E16+ GATAGAGATAAATGTTGGTGTGCTTAAAGAATTTGCCCACTTTAGACCACAGTCTCATAC
                      ____________________________________________________________
consensus GATAGAGATAAATGTTGGTGTGCTTAAAGAATTTGCCCACTTTAGACCACAGTCTCATAC