Previous Contig 012638:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029D13Sequence682006574 (2)gb:BT000874_16351293e-42Arabidopsis thaliana clone C104984 putative NAM (no apical meristem) protein (At676012638 (2)
JMSF047L14Sequence679006574 (2)gb:BT000874_16351297e-43Arabidopsis thaliana clone C104984 putative NAM (no apical meristem) protein (At691012638 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047L14+ CAAAAGGGNGGGGGTGGATGACCACCANCCATNTNTGNCG
                      ____________________________________________________________
consensus CAAAAGGGNGGGGGTGGATGACCACCANCCATNTNTGNCG
 
. : . : . : . : . : . :
rJMSF047L14+ NGNTNTNTCCAGACCAGCNGGGCNTNNGNNGNNGNNGNNGCNTNGTCNTNGTNTTNCNGG
                      ____________________________________________________________
consensus NGNTNTNTCCAGACCAGCNGGGCNTNNGNNGNNGNNGNNGCNTNGTCNTNGTNTTNCNGG
 
. : . : . : . : . : . :
rJMSF047L14+ GGACCNGCNGCNGTTAAGAAGNTCCAGGAACCNTNGTTTTNGCNTTACCAGGTGGCGGAG
rJMSF029D13+ CCAGGNGGCGGAG
                      ____________________________________________________________
consensus GGACCNGCNGCNGTTAAGAAGNTCCAGGAACCNTNGTTTTNGCNTTACCAGGTGGCGGAG
 
. : . : . : . : . : . :
rJMSF047L14+ GAGAAGATAAGCGCAGAAACCAGCGNGAGTAGCAGCACNGAAGTCGGGANTTCGNTTGGC
rJMSF029D13+ GAGAAGATAAGCGCAGAAACCAGCGNGAGTAGCAGCNCNGAAGTNGGGANTTNGNTTGGC
                      ____________________________________________________________
consensus GAGAAGATAAGCGCAGAAACCAGCGNGAGTAGCAGCACNGAAGTCGGGANTTCGNTTGGC
 
. : . : . : . : . : . :
rJMSF047L14+ CTCTCCAGCTACCAAAGCTNTTACGCCGCCGCCGCCGCGCCGCCCTCGGCGCCTTTNTTN
rJMSF029D13+ CTNTCCAGNTACCAAAGNTNNTANGCCGCNGCCGNCGCGCCGCCCTCGGCGCCTTTNTTN
                      ____________________________________________________________
consensus CTCTCCAGCTACCAAAGCTNTTACGCCGCCGCCGCCGCGCCGCCCTCGGCGCCTTTNTTN
 
. : . : . : . : . : . :
rJMSF047L14+ TCCGCTTCCTCCTCCGCCGCCTCCGTCGACGACCTCCACAGGCTAGTCAACTCCCAACAA
rJMSF029D13+ TCCGCTTCCTCNTCCGCCGCCTCCGTCGACGACCTCCACAGGCTAGTCAACTCCCAACAA
                      ____________________________________________________________
consensus TCCGCTTCCTCCTCCGCCGCCTCCGTCGACGACCTCCACAGGCTAGTCAACTCCCAACAA
 
. : . : . : . : . : . :
rJMSF047L14+ CAGATCTCCCTCCAACACCCCCAACTCTTCCAAACCCTCTCCTCCCCGTTCCCGCCGCCG
rJMSF029D13+ CAGATCTCCCTCCAACACCCCCAACTCTTCCAAACCCTCTCCTCCCCGTTCCCGCCGCCG
                      ____________________________________________________________
consensus CAGATCTCCCTCCAACACCCCCAACTCTTCCAAACCCTCTCCTCCCCGTTCCCGCCGCCG
 
. : . : . : . : . : . :
rJMSF047L14+ CCATTGCTGCACCCCCTCCCGCCGCAGCCCTTGGCGCTCCCGCCGGGATCTCTCCACCAG
rJMSF029D13+ CCATTGCTGCACCCCCTCCCGCCGCAGCCCTTGGCGCTCCCGCCGGGATCTCTCCACCAG
                      ____________________________________________________________
consensus CCATTGCTGCACCCCCTCCCGCCGCAGCCCTTGGCGCTCCCGCCGGGATCTCTCCACCAG
 
. : . : . : . : . : . :
rJMSF047L14+ GCTGCCGCCGCCGCCGCTTTCTCCGATAGACTGTGGGATTGGAGCTCAATGGGAGAACCA
rJMSF029D13+ GCTGCCGCCGCCGCCGCTTTCTCCGATAGACTGTGGGATTGGAGCTCAATGGGAGAACCA
                      ____________________________________________________________
consensus GCTGCCGCCGCCGCCGCTTTCTCCGATAGACTGTGGGATTGGAGCTCAATGGGAGAACCA
 
. : . : . : . : . : . :
rJMSF047L14+ AGTAGAGACTATGGCGCTGGCAATCCATTCAGGTAACACTATTATTACATTCATGAAGAT
rJMSF029D13+ AGTAGAGACTATGGCGCTGGCAATCCATTCAAGTAACACTATTATTACATTCATGAAGAT
                      ____________________________________________________________
consensus AGTAGAGACTATGGCGCTGGCAATCCATTCAGGTAACACTATTATTACATTCATGAAGAT
 
. : . : . : . : . : . :
rJMSF047L14+ GATGAGATAAGTATTTTAATTTACATACTTAAAAATGTCCCACTGCACTAATTTATTTTC
rJMSF029D13+ GATGAGATAAGTATTTTAATTTACATACTTAAAAATGTCCCACTGCACTAATTTATTTTC
                      ____________________________________________________________
consensus GATGAGATAAGTATTTTAATTTACATACTTAAAAATGTCCCACTGCACTAATTTATTTTC
 
. : . : . : . : . : . :
rJMSF047L14+ GACTTTAATTTCAAAGACTTATCACACGTTATGATGATAATG
rJMSF029D13+ GACTTTAATTTCAAAGACTTATCACACGTTATGATGATAATGTAAAACTTCTCTAATAAT
                      ____________________________________________________________
consensus GACTTTAATTTCAAAGACTTATCACACGTTATGATGATAATGTAAAACTTCTCTAATAAT
 
. : . : . : . : . : . :
rJMSF029D13+ AGTATCAATCAATTAAGGTGTTACGTTGCAGTTACTACTAGTATATGTTGATTAGGGTTT
                      ____________________________________________________________
consensus AGTATCAATCAATTAAGGTGTTACGTTGCAGTTACTACTAGTATATGTTGATTAGGGTTT
 
. : . : . : . : . : . :
rJMSF029D13+ TAGGTTTAATTAGTTGGAATATTGTAATAATGTTAACTCTTATTATTAGCTATCAACTTT
                      ____________________________________________________________
consensus TAGGTTTAATTAGTTGGAATATTGTAATAATGTTAACTCTTATTATTAGCTATCAACTTT