Previous Contig 012633:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034E02Sequence494012633 (3)pir|H86162|H861629e-15hypothetical protein F15K9.23 - Arabidopsis thaliana>gb:AE005172_889337 Arabidop
JMSF029A18Sequence658006557 (4)pir|G86162|G861621e-18protein F10O3.1 [imported] - Arabidopsis thaliana>gb:AE005172_889336 Arabidopsis657012633 (3)gb:AC105773_17382491e-17Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s
JMSF032M07Sequence685006557 (4)pir|G86162|G861622e-28protein F10O3.1 [imported] - Arabidopsis thaliana>gb:AE005172_889336 Arabidopsis751012633 (3)gb:AC105773_17382491e-27Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF032M07+ GAGTATATGGCATGGCTACAGTCAAATGCAGACAGTGAAGAAATATT
                      ____________________________________________________________
consensus GAGTATATGGCATGGCTACAGTCAAATGCAGACAGTGAAGAAATATT
 
. : . : . : . : . : . :
rJMSF032M07+ TTATCGAGACTCTTTTCAGAAAAGATGGCCTTCTTTGGTTGATGCTGAGAAGCAGATTCA
                      ____________________________________________________________
consensus TTATCGAGACTCTTTTCAGAAAAGATGGCCTTCTTTGGTTGATGCTGAGAAGCAGATTCA
 
. : . : . : . : . : . :
rJMSF032M07+ GGCAGACACCAGTAAGTTACTTGGGAGGAAATATGAACTAAGCTCACGTGTGATGGCGGA
                      ____________________________________________________________
consensus GGCAGACACCAGTAAGTTACTTGGGAGGAAATATGAACTAAGCTCACGTGTGATGGCGGA
 
. : . : . : . : . : . :
rJMSF032M07+ TTTTAGTCCCATGGCAGCTTCAAAATTGTTTGAGCAAGAAATACGTGAAGCGTTCTTGGG
rJMSF029A18+ TAGTCCCATGGCAGCTTCAAAATTGTTTGAGCAAGAAATACGTGAAGCGTTCTTGGG
                      ____________________________________________________________
consensus TTTTAGTCCCATGGCAGCTTCAAAATTGTTTGAGCAAGAAATACGTGAAGCGTTCTTGGG
 
. : . : . : . : . : . :
rJMSF032M07+ GACTTTCGGTGGTCTTGGAGTAGCTGGTCTGTCTGCATCACTTTTGACATCTATTCTAAC
rJMSF029A18+ GACTTTCGGTGGTCTTGGAGTAGCTGGTCTGTCTGCATCACTTTTGACATCTATTCTAAC
                      ____________________________________________________________
consensus GACTTTCGGTGGTCTTGGAGTAGCTGGTCTGTCTGCATCACTTTTGACATCTATTCTAAC
 
. : . : . : . : . : . :
rJMSF032M07+ AACAACATTAGAAGATCTTCTTGCTCTCGGCCTTTGTTCTGCGGGAGGTTTACTAGCGGT
JMFN034E02- TTCTTGCTCTCGGCCTTTGTTCTGCGGGAGGTTTACTAGCGGT
rJMSF029A18+ AACAACATTAGAAGATCTTCTTGCTCTCGGCCTTTGTTCTGCGGGAGGTTTACTAGCGGT
                      ____________________________________________________________
consensus AACAACATTAGAAGATCTTCTTGCTCTCGGCCTTTGTTCTGCGGGAGGTTTACTAGCGGT
 
. : . : . : . : . : . :
rJMSF032M07+ CTCCAATTTCCCAGCCCGTAGGCAACAGGTTGTGAAAAAAGTGAAGAGAACCGGAGATGG
JMFN034E02- CTCCAATTTCCCAGCCCGTAGGCAACAGGTTGTGAAAAAAGTGAAGAGAACCGGAGATGG
rJMSF029A18+ CTCCAATTTCCCAGCCCGTAGGCAACAGGTTGTGAAAAAAGTGAAGAGAACCGGAGATGG
                      ____________________________________________________________
consensus CTCCAATTTCCCAGCCCGTAGGCAACAGGTTGTGAAAAAAGTGAAGAGAACCGGAGATGG
 
. : . : . : . : . : . :
rJMSF032M07+ CTTAGCACGAGAAATTGAAGAGGCAATGCAGAAGGATCTGTTGGAGACAATGGCGTATTT
JMFN034E02- CTTAGCACGAGAAATTGAAGAGGCAATGCAGAAGGATCTGTTGGAGACAATGGCGTATTT
rJMSF029A18+ CTTAGCACGAGAAATTGAAGAGGCAATGCAGAAGGATCTGTTGGAGACAATGGCGTATTT
                      ____________________________________________________________
consensus CTTAGCACGAGAAATTGAAGAGGCAATGCAGAAGGATCTGTTGGAGACAATGGCGTATTT
 
. : . : . : . : . : . :
rJMSF032M07+ GGAGGACATAGTGAAGTTCATCGGCAAGCCATATCAAGAAGCAGCGCAGAATAGACTGGA
JMFN034E02- GGAGGACATAGTGAAGTTCATCGGCAAGCCATATCAAGAAGCAGCGCAGAATAGACTGGA
rJMSF029A18+ GGAGGACATAGTGAAGTTCATCGGCAAGCCATATCAAGAAGCAGCGCAGAATAGACTGGA
                      ____________________________________________________________
consensus GGAGGACATAGTGAAGTTCATCGGCAAGCCATATCAAGAAGCAGCGCAGAATAGACTGGA
 
. : . : . : . : . : . :
rJMSF032M07+ TAAGCTTTTGGCGACTGCAGATAATCTGACCGATATCGAGAGCAAACTGAAAACATTGCA
JMFN034E02- TAAGCTTTTGGCGACTGCAGATAATCTGACCGATATCGAGAGCAAACTGAAAACATTGCA
rJMSF029A18+ TAAGCTTTTGGCGACTGCAGATAATCTGACCGATATCGAGAGCAAACTGAAAACATTGCA
                      ____________________________________________________________
consensus TAAGCTTTTGGCGACTGCAGATAATCTGACCGATATCGAGAGCAAACTGAAAACATTGCA
 
. : . : . : . : . : . :
rJMSF032M07+ AAATGAAATTCAAAATCTCCATGTATCATGATTCATGAATTAGGTTTTGGGAATATGCTT
JMFN034E02- AAATGAAATTCAAAATCTCCATGTATCATGATTCATGAATTAGGTTTTGGGAATATGCTT
rJMSF029A18+ AAATGAAATTCAAAATCTCCATGTATCATGATTCATGAATTAGGTTTTGGGAATATGCTT
                      ____________________________________________________________
consensus AAATGAAATTCAAAATCTCCATGTATCATGATTCATGAATTAGGTTTTGGGAATATGCTT
 
. : . : . : . : . : . :
rJMSF032M07+ CCACAGAGAAACAAAGGAGGAATCATCGGCATGTTGTCGAATGTACATGTATATAGCTGT
JMFN034E02- CCACAGAGAAACAAAGGAGGAATCATCGGCATGTTGTCGAATGTACATGTATATAGCTGT
rJMSF029A18+ CCACAGAGAAACAAAGGAGGAATCATCGGCATGTTGTCGAATGTACATGTATATAGCTGT
                      ____________________________________________________________
consensus CCACAGAGAAACAAAGGAGGAATCATCGGCATGTTGTCGAATGTACATGTATATAGCTGT
 
. : . : . : . : . : . :
rJMSF032M07+ GATGCCAATAACAAAATCGAATGTTGTATTAGTGCAGGAGT
JMFN034E02- GATGCCAATAACAAAATCGAATGTTGTATTAGTGCAGGAGTTGATTGTTTAAAAAAACAT
rJMSF029A18+ GATGCCAATAACAAAATCGAATGTTGTATTAGTGCAGGAGTTGATTGTTTAAAAAAACAT
                      ____________________________________________________________
consensus GATGCCAATAACAAAATCGAATGTTGTATTAGTGCAGGAGTTGATTGTTTAAAAAAACAT
 
. : . : . : . : . : . :
JMFN034E02- TGATTGTTTTATTGAGTTTATTCTTCTTCAC
rJMSF029A18+ TGATTGTTTTATTGAGTTTATTCTTCTTCACATTCACATTCCAATGACCAATGGTGCTAT
                      ____________________________________________________________
consensus TGATTGTTTTATTGAGTTTATTCTTCTTCACATTCACATTCCAATGACCAATGGTGCTAT