Previous Contig 012631:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028P13Sequence717012631 (2)617012631 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028P13- GAGCAACAAATAACAATAAACAAACCACTACACGCACTAGCTAATAGCTATGAAGC
                      ____________________________________________________________
consensus GAGCAACAAATAACAATAAACAAACCACTACACGCACTAGCTAATAGCTATGAAGC
 
. : . : . : . : . : . :
JMSF028P13- TTCCCAAACTCACTTCTTTCTTTCTCATCTTCTTCTTCGTTTCTTCTTTTTTAGCTCAAG
                      ____________________________________________________________
consensus TTCCCAAACTCACTTCTTTCTTTCTCATCTTCTTCTTCGTTTCTTCTTTTTTAGCTCAAG
 
. : . : . : . : . : . :
JMSF028P13- CAAGAAGATTGCAAGAGAATTATGAGGATGAGCTGAAGAAGACAAAATCCAGCTATCAGC
                      ____________________________________________________________
consensus CAAGAAGATTGCAAGAGAATTATGAGGATGAGCTGAAGAAGACAAAATCCAGCTATCAGC
 
. : . : . : . : . : . :
JMSF028P13- CATTATCTTATAACGAAAAGCTTCCAGCTGCTACCGGTGAATTCCTCTTGACGCTGCGTT
                      ____________________________________________________________
consensus CATTATCTTATAACGAAAAGCTTCCAGCTGCTACCGGTGAATTCCTCTTGACGCTGCGTT
 
. : . : . : . : . : . :
JMSF028P13- TGGAGCTTCCAACATCGCAGGATTCACAAAGCTTCTTTGAGCGTTTCAATGGCGTAAACG
                      ____________________________________________________________
consensus TGGAGCTTCCAACATCGCAGGATTCACAAAGCTTCTTTGAGCGTTTCAATGGCGTAAACG
 
. : . : . : . : . : . :
JMSF028P13- CCTACATGCTGACGTTGAGTTCTTTAAGGTCCAAAGACTTCGGAAGAGAACCAAAGTCGC
                      ____________________________________________________________
consensus CCTACATGCTGACGTTGAGTTCTTTAAGGTCCAAAGACTTCGGAAGAGAACCAAAGTCGC
 
. : . : . : . : . : . :
JMSF028P13- CGCCGCCTTCTCCGAAGCCGTCTGGTCCTAATCACCCAACTATTATCCCCTCCGATCTAA
                      ____________________________________________________________
consensus CGCCGCCTTCTCCGAAGCCGTCTGGTCCTAATCACCCAACTATTATCCCCTCCGATCTAA
 
. : . : . : . : . : . :
JMSF028P13- ACACGGCCGGAGAGTTTGGACGGGGGCAAAAGTCGCCGCCTCCGGCTCCGGAAATAGATC
                      ____________________________________________________________
consensus ACACGGCCGGAGAGTTTGGACGGGGGCAAAAGTCGCCGCCTCCGGCTCCGGAAATAGATC
 
. : . : . : . : . : . :
JMSF028P13- CCCCCCACCACCCAACTATTATCCCCTACGGTCTAAGCTCGGGCGGAGAGTTTGGACGGG
rJMSF028P13+ GGAGAGTTNGGNCGGG
                      ____________________________________________________________
consensus CCCCCCACCACCCAACTATTATCCCCTACGGTCTAAGCTCGGGCGGAGAGTTTGGACGGG
 
. : . : . : . : . : . :
JMSF028P13- AGGAAAAGTCGCCGCCTCCGGCTCCGGAAACAGATATCCCCGAACACCCAACAATTACCA
rJMSF028P13+ AGGAAAAGTNGCCGCNTCNGGNTCCGGAAACAGATATCNCCGAACACCCAACAATTACCA
                      ____________________________________________________________
consensus AGGAAAAGTCGCCGCCTCCGGCTCCGGAAACAGATATCCCCGAACACCCAACAATTACCA
 
. : . : . : . : . : . :
JMSF028P13- CCTCGAATTATGGACGGCTGCCGAAGTCACCGCCTCCGGCTCNGGAAACAGAACCCCCCC
rJMSF028P13+ CCTNGAATTATGGACGGCTGCNGAAGTCACCGCNTCCGGCTCCGGAAACAGAACCCCCCC
                      ____________________________________________________________
consensus CCTCGAATTATGGACGGCTGCCGAAGTCACCGCCTCCGGCTCCGGAAACAGAACCCCCCC
 
. : . : . : . : . : . :
JMSF028P13- ACCACCC-ACAATTACCACCTCGAA-TATGGACGGCTGCCGAAGTCACCGCCTC
rJMSF028P13+ ACCACCCAACAATTACCACCTCGAATTATGGACGGCTGCCGAAGTCACCGCCTCCGGCTC
                      ____________________________________________________________
consensus ACCACCCAACAATTACCACCTCGAATTATGGACGGCTGCCGAAGTCACCGCCTCCGGCTC
 
. : . : . : . : . : . :
rJMSF028P13+ CGGAAACAGAACCCCCCCACCACCCAACAATTACCACCTCGAGTAGTTATGGACGGCAGG
                      ____________________________________________________________
consensus CGGAAACAGAACCCCCCCACCACCCAACAATTACCACCTCGAGTAGTTATGGACGGCAGG
 
. : . : . : . : . : . :
rJMSF028P13+ CGAGATCGCCGCCTCCGGCTCCAAAGCCAGGACCGCCAATCCACCCTGGAAACAGCGGCG
                      ____________________________________________________________
consensus CGAGATCGCCGCCTCCGGCTCCAAAGCCAGGACCGCCAATCCACCCTGGAAACAGCGGCG
 
. : . : . : . : . : . :
rJMSF028P13+ GCGGCGCACAAGTGATTTCAATGGCGGACGACTCAAGTGATTTCCTGTCATCAGCCTGAG
                      ____________________________________________________________
consensus GCGGCGCACAAGTGATTTCAATGGCGGACGACTCAAGTGATTTCCTGTCATCAGCCTGAG
 
. : . : . : . : . : . :
rJMSF028P13+ CTCATGTATTATGATCTCAATGATAATATGCTTTTGTGTTGAGTATTAGATTAGCAGTTT
                      ____________________________________________________________
consensus CTCATGTATTATGATCTCAATGATAATATGCTTTTGTGTTGAGTATTAGATTAGCAGTTT
 
. : . : . : . : . : . :
rJMSF028P13+ AGAATAAGATAATTGTTGTAGTTTGTTTACAAATTATAGTTTCAGTATTATTTAATATTA
                      ____________________________________________________________
consensus AGAATAAGATAATTGTTGTAGTTTGTTTACAAATTATAGTTTCAGTATTATTTAATATTA
 
. : . : . : . : . : . :
rJMSF028P13+ TGTTTGAGCATGTAAACCTTAAATAAAAGGTGTTACATCTTCTTATTAAATGTGTAATAT
                      ____________________________________________________________
consensus TGTTTGAGCATGTAAACCTTAAATAAAAGGTGTTACATCTTCTTATTAAATGTGTAATAT