Previous Contig 012618:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017M18Sequence477003067 (4)gb:AK117304_18153442e-22Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA765012618 (3)gb:AK117304_18153443e-70Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA
JMSF018C08Sequence454003067 (4)gb:AK117304_18153441e-06Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA796012618 (3)gb:AK117304_18153444e-79Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA
JMSF028L18Sequence634003067 (4)gb:AK117304_18153445e-44Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA788012618 (3)gb:AK117304_18153445e-79Arabidopsis thaliana At3g16260 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017M18+ TGAGTCACATGAAGACAACGATGTGGAAAGAGGGAAA
rJMSF018C08+ ATTGAAGGCTTTTGAGTCACATGAAGACAACGATGTGGAAAGAGGGAAA
rJMSF028L18+ GAGGGAAA
                      ____________________________________________________________
consensus ATTGAAGGCTTTTGAGTCACATGAAGACAACGATGTGGAAAGAGGGAAA
 
. : . : . : . : . : . :
rJMSF017M18+ GCACCTGGGCTAAAGGACCAACAGACTGATTCTAGTCTATTTGTGAAAGGGGATCGCATG
rJMSF018C08+ GCACCTGGGCTAAAGGACCAACAGACTGATTCTAGTCTATTTGTGAAAGGGGATCGCATG
rJMSF028L18+ GCACCTGGGCTAAAGGACCAACAGACTGATTNTAGTCTATTTGTGAAAGGGGATCGCATG
                      ____________________________________________________________
consensus GCACCTGGGCTAAAGGACCAACAGACTGATTCTAGTCTATTTGTGAAAGGGGATCGCATG
 
. : . : . : . : . : . :
rJMSF017M18+ CAGAGCTATTGGAAGAGGCCAGGCAGTCCAGTTGACTCATCTGTGTTCTTCCCAATTTTG
rJMSF018C08+ CAGAGCTATTGGAAGAGGCCAGGCAGTCCAGTTGACTCATCTGTGTTCTTCCCAATTTTG
rJMSF028L18+ CAGAGCTATTGGAAGAGGCCAGGCAGTCCAGTTGACTCATCTGTGTTCTTCCCAATTTTG
                      ____________________________________________________________
consensus CAGAGCTATTGGAAGAGGCCAGGCAGTCCAGTTGACTCATCTGTGTTCTTCCCAATTTTG
 
. : . : . : . : . : . :
rJMSF017M18+ AAGAACCTGAAGGGTGTATTAAACGAAGCAGGATTAGAAGCATTGATAAGTTTCCCTGTT
rJMSF018C08+ AAGAACCTGAAGGGTGTATTAAACGAAGCAGGATTAGAAGCATTGATAAGTTTCCCTGTT
rJMSF028L18+ AAGAACCTGAAGGGTGTATTAAACGAAGCAGGATTAGAAGCATTGATAAGTTTCCCTGTT
                      ____________________________________________________________
consensus AAGAACCTGAAGGGTGTATTAAACGAAGCAGGATTAGAAGCATTGATAAGTTTCCCTGTT
 
. : . : . : . : . : . :
rJMSF017M18+ ATTCATTGTCCACAAGCTTATGGAGTAGCACTAAAAGCTGCTGATAGAACTAATAGTGCT
rJMSF018C08+ ATTCATTGTCCACAAGCTTATGGAGTAGCACTAAAAGCTGCTGATAGAACTAATAGTGCT
rJMSF028L18+ ATTCATTGTCCACAAGCTTATGGAGTAGCACTAAAAGCTGCTGATAGAACTAATAGTGCT
                      ____________________________________________________________
consensus ATTCATTGTCCACAAGCTTATGGAGTAGCACTAAAAGCTGCTGATAGAACTAATAGTGCT
 
. : . : . : . : . : . :
rJMSF017M18+ GGGAAAAGGATACCGGGATGGAAGATTGTTTACTCTGGTGATACTAGGCCCTGTCCAGAT
rJMSF018C08+ GGGAAAAGGATACCGGGATGGAAGATTGTTTACTCTGGTGATACTAGGCCCTGTCCAGAT
rJMSF028L18+ GGGAAAAGGATACCGGGATGGAAGATTGTTTACTCTGGTGATACTAGGCCCTGTCCAGAT
                      ____________________________________________________________
consensus GGGAAAAGGATACCGGGATGGAAGATTGTTTACTCTGGTGATACTAGGCCCTGTCCAGAT
 
. : . : . : . : . : . :
rJMSF017M18+ CTGGTTGAAGCTTCTCGTGGAGCAACAGTTCTCATACACGAGGCTACA-TTGAAGATGGC
rJMSF018C08+ CTGGTTGAAGCTTCTCGTGGAGCAACAGTTCTCATACACGAGGCTACATTTGAAGATGGC
rJMSF028L18+ CTGGTTGAAGCTTCTCGTGGAGCAACAGTTCTCATACACGAGGCTACATTTGAAGATGGC
                      ____________________________________________________________
consensus CTGGTTGAAGCTTCTCGTGGAGCAACAGTTCTCATACACGAGGCTACATTTGAAGATGGC
 
. : . : . : . : . : . :
rJMSF017M18+ ATGGTGGACGAGGCAATAGCAAGAAATCACAGCACAACAAAGGAAGCTATTGAAGTGGGG
rJMSF018C08+ ATGGTGGACGAGGCAATAGCAAGAAATCACAGCACAACAAAGGAAGCTATTGAAGTGGGG
rJMSF028L18+ ATGGTGGACGAGGCAATAGCAAGAAATCACAGCACAACAAAGGAAGCTATTGAAGTGGGG
                      ____________________________________________________________
consensus ATGGTGGACGAGGCAATAGCAAGAAATCACAGCACAACAAAGGAAGCTATTGAAGTGGGG
 
. : . : . : . : . : . :
rJMSF017M18+ GATAGCGCTGGAGCATATCGTATCATCCTTACTCACTTCAGCCAAAGATACCCTAAAATC
rJMSF018C08+ GATAGCGCTGGAGCATATCGTATCATCCTTACTCACTTCAGCCAAAGATACCCTAAAATC
rJMSF028L18+ GATAGCGCTGGAGCATATCGTATCATCCTTACTCACTTCAGCCAAAGATACCCTAAAATC
                      ____________________________________________________________
consensus GATAGCGCTGGAGCATATCGTATCATCCTTACTCACTTCAGCCAAAGATACCCTAAAATC
 
. : . : . : . : . : . :
rJMSF017M18+ ACAGTTTTTGATGAATCCCACATGCACAAAACCTGCATTGCTTTTGATATGATGAGTATA
rJMSF018C08+ CCAGTTTTTGATGAATCCCACATGCACAAAACCTGCATTGCTTTTGATATGATGAGTATA
rJMSF028L18+ CCAGTTTTTGATGAATCCCACATGCACAAAACCTGCATTGCTTTTGATATGATGAGTATA
                      ____________________________________________________________
consensus CCAGTTTTTGATGAATCCCACATGCACAAAACCTGCATTGCTTTTGATATGATGAGTATA
 
. : . : . : . : . : . :
rJMSF017M18+ AATGCAGCAGATCTGCCTATGCTTCCAAGAGTCCTTCCATACCTTAAGCTCC--TTTCGT
rJMSF018C08+ AATGCAGCAGATCTGCCTATGCTTCCAAGAGTCCTTCCATACCTTAAGCTCCTATTTCGT
rJMSF028L18+ AATGCAGCAGATCTGCCTATGCTTCCAAGAGTCCTTCCATACCTTAAGCTCCTATTTCGT
                      ____________________________________________________________
consensus AATGCAGCAGATCTGCCTATGCTTCCAAGAGTCCTTCCATACCTTAAGCTCCTATTTCGT
 
. : . : . : . : . : . :
rJMSF017M18+ GATGACCTCGCGGTTGACGAATCCTTTGATGCAAATGTTACAACTGCTATTCGTGATGAG
rJMSF018C08+ GATGACCTCGCGGTTGACGAATCCTTTGATGCAAATGTTACAACTGCTATTCGTGATGAG
rJMSF028L18+ GATGACCTCGCGGTTGACGAATCCTTTGATGCAAATGTTACAACTGCTATTCGTGATGAG
                      ____________________________________________________________
consensus GATGACCTCGCGGTTGACGAATCCTTTGATGCAAATGTTACAACTGCTATTCGTGATGAG
 
. : . : . : . : . : . :
rJMSF017M18+ CTCATGGTTGATGAATCTGATGATGCGGCAGCAGCAGCAGATGTTACAACTGTTCTTGC-
rJMSF018C08+ CTCATGGTTGATGAATCTGATGATGCGGCAGCAGCAGCAGATGTTACAACTGTTCTTGCT
rJMSF028L18+ CTCATGGTTGATGAATCTGATGATGCGGCAGCAGCAGCAGATGTTACAACTGTTCTTGCT
                      ____________________________________________________________
consensus CTCATGGTTGATGAATCTGATGATGCGGCAGCAGCAGCAGATGTTACAACTGTTCTTGCT
 
. : . : . : . : . : . :
rJMSF017M18+ TGAAAAACACAT
rJMSF018C08+ TGAAAAACACATACTACTATAAATGTA
rJMSF028L18+ TGAAAAACACATACTACTATAAATGTATTAATTATTATTTTTAACTGAAGAAAACAAAAT
                      ____________________________________________________________
consensus TGAAAAACACATACTACTATAAATGTATTAATTATTATTTTTAACTGAAGAAAACAAAAT