Previous Contig 012614:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001C14Sequence338006534 (3)gb:AP003368_18285813e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B110769012614 (3)gb:AP003368_18285807e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B110
JMSF028J01Sequence660006534 (3)pir|D86247|D862471e-26hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890139 Arabid705012614 (3)gb:AP003368_18285804e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B110
JMSF031J08Sequence671006534 (3)pir|D86247|D862479e-36hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_890139 Arabid778012614 (3)gb:ITU20948_16833002e-59Ipomoea trifida receptor protein kinase (IRK1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031J08+ AATGCGGTATGTTAGATNGGAGAAGCGCTTGNAATTATCTTAGGAGNTGC
                      ____________________________________________________________
consensus AATGCGGTATGTTAGATNGGAGAAGCGCTTGNAATTATCTTAGGAGNTGC
 
. : . : . : . : . : . :
rJMSF031J08+ TCGAGGATTGTTATATCTTCATCAAGATTCTAGATTAAAAATTATTCACAGAGATTTAAA
rJMSF001C14+ ACAGAGATTTAAN
                      ____________________________________________________________
consensus TCGAGGATTGTTATATCTTCATCAAGATTCTAGATTAAAAATTATTCACAGAGATTTAAA
 
. : . : . : . : . : . :
rJMSF031J08+ GGCTGGCAATATTCTGTTAGATGCTTCCATGCACCCGAAGATATCTGACTTTGGAATGGC
rJMSF001C14+ GGCTGGCAATATTCTGTTAGATGCTTCCATGCACCCGAAGATATCTGACTTTGGAATGGC
                      ____________________________________________________________
consensus GGCTGGCAATATTCTGTTAGATGCTTCCATGCACCCGAAGATATCTGACTTTGGAATGGC
 
. : . : . : . : . : . :
rJMSF031J08+ TAGAATTTTTGGAGGGGACCAAATTGAAGCAAGCACAAATAGAGTGGTTGGGACATATGG
rJMSF001C14+ TAGAATTTTTGGAGGGGACCAAATTGAAGCAAGCACAAATAGAGTGGTTGGGACATATGG
rJMSF028J01+ GGGACCAAATTGAAGCCAGCACAAATAGAGTGGTTGGGACATATGG
                      ____________________________________________________________
consensus TAGAATTTTTGGAGGGGACCAAATTGAAGCAAGCACAAATAGAGTGGTTGGGACATATGG
 
. : . : . : . : . : . :
rJMSF031J08+ GTATATGTCACCGGAATATGCAATGGAAGGCCATTTTTCAGAAAAGTCTGATGTCTATAG
rJMSF001C14+ GTATATGTCACCGGAATATGCAATGGAAGGCCATTTTTCAGAAAAGTCTGATGTCTATAG
rJMSF028J01+ GTATATGTCACCGGAATATGCAATGGAAGGCCATTTTTCAGAAAAGTCTGATGTCTATAG
                      ____________________________________________________________
consensus GTATATGTCACCGGAATATGCAATGGAAGGCCATTTTTCAGAAAAGTCTGATGTCTATAG
 
. : . : . : . : . : . :
rJMSF031J08+ TTTTGGTGTTTTATTGCTGGAGATTGTGACGGGAAAGAAGAACAAAAATCCAAATAACGA
rJMSF001C14+ TTTTGGTGTTTTATTGCTGGAGATTGTGACGGGAAAGAAGAACAAAAATCCAAATAACGA
rJMSF028J01+ TTTTGGTGTTTTATTGCTGGAGATTGTGACGGGAAAGAAGAACAAAAATCCAAATAACGA
                      ____________________________________________________________
consensus TTTTGGTGTTTTATTGCTGGAGATTGTGACGGGAAAGAAGAACAAAAATCCAAATAACGA
 
. : . : . : . : . : . :
rJMSF031J08+ AAAATCTATGAATTTAATAACAAATGTATGGGATTTCTGGAACGAAAATAGGGCATTTGA
rJMSF001C14+ AAAATCTATGAATTTAATAACAAATGTATGGGATTTCTGGAACGAAAATAGGGCATTTGA
rJMSF028J01+ AAAATCTATGAATTTAATAACAAATGTATGGGATTTCTGGAACGAAAATAGGGCATTTGA
                      ____________________________________________________________
consensus AAAATCTATGAATTTAATAACAAATGTATGGGATTTCTGGAACGAAAATAGGGCATTTGA
 
. : . : . : . : . : . :
rJMSF031J08+ TATAGTTGATCCATCATTAGGAGAGTGGTATGATGATCGACAAGTTTTGAGATGCATCCA
rJMSF001C14+ TATAGTTGATCCATCATTAGGAGAGTGGTATGATGATCGACAAGTTTTGAGATGCATCCA
rJMSF028J01+ TATAGTTGATCCATCATTAGGAGAGTGGTATGATGATCGACAAGTTTTGAGATGCATCCA
                      ____________________________________________________________
consensus TATAGTTGATCCATCATTAGGAGAGTGGTATGATGATCGACAAGTTTTGAGATGCATCCA
 
. : . : . : . : . : . :
rJMSF031J08+ TGTTGGGTTGTTATGCGTTCAATCATATTCAGACGATAGACCAATCATGTCAGAAGTGAT
rJMSF001C14+ TGTTGGGTTGTTATGCGTTCAATCATATTCAGACGATAGACCAATCATGTCAGAAGTGAT
rJMSF028J01+ TGTTGGGTTGTTATGCGTTCAATCATATTCAGACGATAGACCAATCATGTCAGAAGTGAT
                      ____________________________________________________________
consensus TGTTGGGTTGTTATGCGTTCAATCATATTCAGACGATAGACCAATCATGTCAGAAGTGAT
 
. : . : . : . : . : . :
rJMSF031J08+ TTTCATGCTAAGTAATGAAACCGAACTTCCTCAACCTAATCAACCGGGTTTTATATTCAA
rJMSF001C14+ TTTCATGCTAAGTAATGAAACCGAACTTCCTCAACCTAATCAACCGGGTTTTATATTCAA
rJMSF028J01+ TTTCATGCTAAGTAATGAAACCGAACTTCCTCAACCTAATCAACCGGGTTTTATATTCAA
                      ____________________________________________________________
consensus TTTCATGCTAAGTAATGAAACCGAACTTCCTCAACCTAATCAACCGGGTTTTATATTCAA
 
. : . : . : . : . : . :
rJMSF031J08+ ACATGGAAGTGGTTTTCTACCCTCAACTTCAACGAGTACTCTCGAAAACCAATCTATTAA
rJMSF001C14+ ACATGGAAGTGGTTTTCTACCCTCAACTTCAACGAGTACTCTCGAAAACCAATCTATTAA
rJMSF028J01+ ACATGGAAGTGGTTTTCTACCCTCAACTTCAACGAGTACTCTCGAAAACCAATCTATTAA
                      ____________________________________________________________
consensus ACATGGAAGTGGTTTTCTACCCTCAACTTCAACGAGTACTCTCGAAAACCAATCTATTAA
 
. : . : . : . : . : . :
rJMSF031J08+ TGACATGTCGATTACCAAGATTGAAGGTCGCTAACATATATTACCTACTGATTAGGTATG
rJMSF001C14+ TGACATGTCGATTACCAAGATTGAAGGTCGCTAACATATATTACCTACTGATTAGGTATG
rJMSF028J01+ TGACATGTCGATTACCAAGATTGAAGGTCGCTAACATATATTACCTACTGATTAGGTATG
                      ____________________________________________________________
consensus TGACATGTCGATTACCAAGATTGAAGGTCGCTAACATATATTACCTACTGATTAGGTATG
 
. : . : . : . : . : . :
rJMSF031J08+ AAATTATTGTATGGCTCTTTTCAAACTTTTTCCGTTGTTGACTTCTTGTTATTGTCTCAT
rJMSF001C14+ AAATTATTGTATGGCTCTTTTCAAACTTTTTCCGTTGTTGACTTCTTGTTATTGTCTCAT
rJMSF028J01+ AAATTATTGTATGGCTCTTTTCAAACTTTTTCCGTTGTTGACTTCTTGTTATTGTCTCAT
                      ____________________________________________________________
consensus AAATTATTGTATGGCTCTTTTCAAACTTTTTCCGTTGTTGACTTCTTGTTATTGTCTCAT
 
. : . : . : . : . : . :
rJMSF031J08+ TGTATAAT
rJMSF001C14+ TGTATAATATGTTTATTTATTAGGAGATGAAAATAAACTTTTTGTCACATATCTTAGGGA
rJMSF028J01+ TGTATAATATGTTTATTTATTAGGAGATGAAAATAAACTTTTTGTCACATATCTTAGGGA
                      ____________________________________________________________
consensus TGTATAATATGTTTATTTATTAGGAGATGAAAATAAACTTTTTGTCACATATCTTAGGGA
 
. : . : . : . : . : . :
rJMSF001C14+ AAGAGTGTTTGGTTCCAGGGAAGGGGAATCAAATA
rJMSF028J01+ AAGTGTGTTTGGTT-CAGGGAAGGGGAATCAAATANCTTGATAATTTGAATGAATTCTGG
                      ____________________________________________________________
consensus AAGTGTGTTTGGTTCCAGGGAAGGGGAATCAAATANCTTGATAATTTGAATGAATTCTGG