Previous Contig 012612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015A21Sequence468012612 (4)gb:AY087769_15727961e-26Arabidopsis thaliana clone 38304 mRNA, complete sequence.750012612 (4)gb:AY087769_15727963e-64Arabidopsis thaliana clone 38304 mRNA, complete sequence.
JMSF028I22Sequence687012612 (4)gb:AY087769_15727964e-76Arabidopsis thaliana clone 38304 mRNA, complete sequence.649012612 (4)gb:AY087769_15727963e-62Arabidopsis thaliana clone 38304 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF015A21- GAGTGCTCCA
                      ____________________________________________________________
consensus GAGTGCTCCA
 
. : . : . : . : . : . :
JMSF015A21- CGACCTCTGCTTGTAAAGTTTGTATGGCTGAAAATGGATATGAATTAACGCCATTAACGG
                      ____________________________________________________________
consensus CGACCTCTGCTTGTAAAGTTTGTATGGCTGAAAATGGATATGAATTAACGCCATTAACGG
 
. : . : . : . : . : . :
JMSF015A21- TCAGTTTCCAGTTTCCAGTTTCCTTGTATCGAACTTTCTATAAGAACGTTGTGTTTCGAC
                      ____________________________________________________________
consensus TCAGTTTCCAGTTTCCAGTTTCCTTGTATCGAACTTTCTATAAGAACGTTGTGTTTCGAC
 
. : . : . : . : . : . :
JMSF015A21- TATATGGATTCTGATTGTTCAGTGTTTGGATAATGAGTGCGGCTTGTTATGGGGGATTTC
JMSF028I22- CTGATTGTTCAGTGTTTGGATAATGAGTGCGGCTTGTTATGGGGGATTTC
                      ____________________________________________________________
consensus TATATGGATTCTGATTGTTCAGTGTTTGGATAATGAGTGCGGCTTGTTATGGGGGATTTC
 
. : . : . : . : . : . :
JMSF015A21- GACACCATCCCCGGTTGGGATTGTGCAATTCCAGGATAGTGTGTTTATCGGAATCCGGCG
JMSF028I22- GACACCATCCCCGGTTGGGATTGTGCAATTCCAGGATAGTGTGTTTATCGGAATCCGGCG
                      ____________________________________________________________
consensus GACACCATCCCCGGTTGGGATTGTGCAATTCCAGGATAGTGTGTTTATCGGAATCCGGCG
 
. : . : . : . : . : . :
JMSF015A21- GTGGAGTACGGTGGCAATTACTGAAAAGAGTGGATGAGGAGCTGAGCAAAGGAGATGAAA
JMSF028I22- GTGGAGTACGGTGGCAATTACTGAAAAGAGTGGATGAGGAGCTGAGCAAAGGAGATGAAA
                      ____________________________________________________________
consensus GTGGAGTACGGTGGCAATTACTGAAAAGAGTGGATGAGGAGCTGAGCAAAGGAGATGAAA
 
. : . : . : . : . : . :
JMSF015A21- GAGCAGCACTGTCCCTAGTTAAAGACTTGCAAGGCAAACCCGGCGGCCTCAGGTGTTTCG
JMSF028I22- GAGCAGCACTGTCCCTAGTTAAAGACTTGCAAGGCAAACCCGGCGGCCTCAGGTGTTTCG
                      ____________________________________________________________
consensus GAGCAGCACTGTCCCTAGTTAAAGACTTGCAAGGCAAACCCGGCGGCCTCAGGTGTTTCG
 
. : . : . : . : . : . :
JMSF015A21- GCGCCGCCCGCCAGATACCCCAGCAACTATATTCGTTGGAGGAGCTGAGATTGAATGGAA
JMSF028I22- GCGCCGCCCGCCAGATACCCCAGCAACTATATTCGTTGGAGGAGCTGAGATTGAATGGAA
                      ____________________________________________________________
consensus GCGCCGCCCGCCAGATACCCCAGCAACTATATTCGTTGGAGGAGCTGAGATTGAATGGAA
 
. : . : . : . : . : . :
JMSF015A21- TAGAAACCGTGTCTCTTTTATCACCAGTTGATGCCACA
JMSF028I22- TAGAAACCGTGTCTCTTTTATCACCAGTTGATGCCACACTGGGCTCCATAGAAAGAAACC
                      ____________________________________________________________
consensus TAGAAACCGTGTCTCTTTTATCACCAGTTGATGCCACACTGGGCTCCATAGAAAGAAACC
 
. : . : . : . : . : . :
JMSF028I22- TCCAAATTGCAGCTTTATCTGGTGGGGTAGCTGCTTGGAATGTGCTAAACTTAAACCCTC
rJMSF015A21+ GTGGGGTAGCTGCTTGGAATGTGCTAAACTTAAACCCTC
                      ____________________________________________________________
consensus TCCAAATTGCAGCTTTATCTGGTGGGGTAGCTGCTTGGAATGTGCTAAACTTAAACCCTC
 
. : . : . : . : . : . :
JMSF028I22- AACAGATCCTCTACATCTCTTTGGGACTTTTGTTTTTGTTGACATTTGACTCGGTATCCT
rJMSF015A21+ AACAGATCCTCTACATCTCTTTGGGACTTTTGTTTTTGTTGACATTTGACTCGGTATCCT
                      ____________________________________________________________
consensus AACAGATCCTCTACATCTCTTTGGGACTTTTGTTTTTGTTGACATTTGACTCGGTATCCT
 
. : . : . : . : . : . :
JMSF028I22- TTAATGGAGGGTTCGGTGCCTTGATTCTAGATACCATTGGTCATACCCTCAGCGAAAAAT
rJMSF015A21+ TTAATGGAGGGTTCGGTGCCTTGATTCTAGATACCATTGGTCATACCCTCAGCGAAAAAT
                      ____________________________________________________________
consensus TTAATGGAGGGTTCGGTGCCTTGATTCTAGATACCATTGGTCATACCCTCAGCGAAAAAT
 
. : . : . : . : . : . :
JMSF028I22- ACCACAACAGGGTTATTCAGCATGAAGCAGGGCATTTCTTGATTGCCTACTTGCTAGGAA
rJMSF015A21+ ACCACAACAGGGTTATTCAGCATGAAGCAGGGCATTTCTTGATTGCCTACTTGCTAGGAA
                      ____________________________________________________________
consensus ACCACAACAGGGTTATTCAGCATGAAGCAGGGCATTTCTTGATTGCCTACTTGCTAGGAA
 
. : . : . : . : . : . :
JMSF028I22- TCCTTCCTAGGGGGTACACACTTACCAGTTTGGAAGCTTTGAAGAAGGAAGGATCACTTA
rJMSF015A21+ TCCTTCCTAGGGGGTACACACTTACCAGTTTGGAAGCTTTGAAGAAGGAAGGATCACTTA
                      ____________________________________________________________
consensus TCCTTCCTAGGGGGTACACACTTACCAGTTTGGAAGCTTTGAAGAAGGAAGGATCACTTA
 
. : . : . : . : . : . :
JMSF028I22- ATGTTCAAGCTGGGACAGCATTTGTGGACTTTGAGT
rJMSF015A21+ ATGTTCAAGCTGGGACAGCATTTGTGGACTTTGAGTTCCTCGAGGAACAGGTGTAGCTAC
rJMSF028I22+ CAGGTGTAGCTAC
                      ____________________________________________________________
consensus ATGTTCAAGCTGGGACAGCATTTGTGGACTTTGAGTTCCTCGAGGAACAGGTGTAGCTAC
 
. : . : . : . : . : . :
rJMSF015A21+ AGAGTATCTTCTATTCGGATGTGCAGAGGGAGGACTTGCAGATATTAACCAGTTGGACTT
rJMSF028I22+ AGAGTATCTTCTATTCGGATGTGCAGAGGGAGGACTTGCAGATATTAACCAGTTGGACTT
                      ____________________________________________________________
consensus AGAGTATCTTCTATTCGGATGTGCAGAGGGAGGACTTGCAGATATTAACCAGTTGGACTT
 
. : . : . : . : . : . :
rJMSF015A21+ TCTACTGCAAAGCCTGGGGTTTACACAGAAAAAGGCAGATTCTCAGGTGAGATGGGCTGT
rJMSF028I22+ TCTACTGCAAAGCCTGGGGTTTACACAGAAAAAGGCAGATTCTCAGGTGAGATGGACTGT
                      ____________________________________________________________
consensus TCTACTGCAAAGCCTGGGGTTTACACAGAAAAAGGCAGATTCTCAGGTGAGATGGGCTGT
 
. : . : . : . : . : . :
rJMSF015A21+ ACTGAACACTATACTCATTCTGCGCCGCCATGAGAATGCCCGAGCAAAGCTTGCCGAGGG
rJMSF028I22+ ACTGAACACTATACTCATTCTGCGCCGCCATGAGAATGCCCGAGCAAAGCTTGCCGAGGG
                      ____________________________________________________________
consensus ACTGAACACTATACTCATTCTGCGCCGCCATGAGAATGCCCGAGCAAAGCTTGCCGAGGG
 
. : . : . : . : . : . :
rJMSF015A21+ AATGTCTGAGGGAAGATCTGTGGGCTTTTGCATTGACATTATAGAGAAAAGCATAAGTGA
rJMSF028I22+ AATGTCTGAGGGAAGATCTGTGGGCTTTTGCATTGACATTATAGAGAAAAGCATAAGTGA
                      ____________________________________________________________
consensus AATGTCTGAGGGAAGATCTGTGGGCTTTTGCATTGACATTATAGAGAAAAGCATAAGTGA
 
. : . : . : . : . : . :
rJMSF015A21+ TGATGACTTGTAATTCTTCTTATACTTTTGCCTTAAAAGAAGAGTAATCATTGATTTATA
rJMSF028I22+ TGATGACTTGTAATTCTTCTTATACTTTTGCCTTAAAAGAAGAGTAATCATTGATTTATA
                      ____________________________________________________________
consensus TGATGACTTGTAATTCTTCTTATACTTTTGCCTTAAAAGAAGAGTAATCATTGATTTATA
 
. : . : . : . : . : . :
rJMSF015A21+ TTTTTGCCTCTGTATTCTCATATCATGTATCAGAGTTTTCTTCTGCTTGTATGTATAATT
rJMSF028I22+ TTTTTGCCTCTGTATTCTCATATCATGTATCAGAGTTTTCTTCTGCTTGTATGTATAATT
                      ____________________________________________________________
consensus TTTTTGCCTCTGTATTCTCATATCATGTATCAGAGTTTTCTTCTGCTTGTATGTATAATT
 
. : . : . : . : . : . :
rJMSF015A21+ TTCTTGCCTATGCAGTATGATGCCATGTAATGTGTACATATAGTCATTCT
rJMSF028I22+ TTCTTGCCTATGCAGTATGATGCCATGTAATGTGTACATATAGTCATTCTTGCAGGTACT
                      ____________________________________________________________
consensus TTCTTGCCTATGCAGTATGATGCCATGTAATGTGTACATATAGTCATTCTTGCAGGTACT