Previous Contig 012611:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN039K20Sequence649012611 (4)
JMFN044L06Sequence631012611 (4)
JMSF019E18Sequence492006376 (3)gb:AP003238_18259762e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040731012611 (4)
JMSF028I12Sequence679006376 (3)gb:AP003238_18259761e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040751012611 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN044L06- GCCGAAAACCTCTCTCTCCGCATCGAAGGAGATCTCCAATTGGACGAAGAGGAT
rJMSF019E18+ CGAAGGAGATCTCCAATTGGACGAAGAGGAT
rJMSF028I12+ CGAAGGAGATCTCCAATTGGACGAAGAGGAT
                      ____________________________________________________________
consensus GCCGAAAACCTCTCTCTCCGCATCGAAGGAGATCTCCAATTGGACGAAGAGGAT
 
. : . : . : . : . : . :
JMFN044L06- CTCCTAGACGAGAACCCGACTCTCCTCCCCGTCGGTCTCCTGTTCGTCGTCGAGATTCTC
JMFN039K20- CGTCGTCGAGATTCTC
rJMSF019E18+ CTCCTAGACGAGAACCCGACTCTCCTCCCCGTCGGTCTCCTGTTCGTCGTCGAGATTCTC
rJMSF028I12+ CTCCTAGACGAGAACCCGACTCTCCTCCCCGTCGGTCTCCTGTTCGTCGTCGAGATTCTC
                      ____________________________________________________________
consensus CTCCTAGACGAGAACCCGACTCTCCTCCCCGTCGGTCTCCTGTTCGTCGTCGAGATTCTC
 
. : . : . : . : . : . :
JMFN044L06- CTTATAGACGTGCTGACTCTCCACCTACAAGACGGAGGCTTACACCTCCACCAAGAGGAG
JMFN039K20- CTTATAGACGTGCTGACTCTCCACCTACAAGACGGAGGCTTACACCTCCACCAAGAGGAG
rJMSF019E18+ CTTATAGACGTGCTGACTCTCCACCTACAAGACGGAGGCTTACACCTCCACCAAGAGGAG
rJMSF028I12+ CTTATAGACGTGCTGACTCTCCACCTACAAGACGGAGGCTTACACCTCCACCAAGAGGAG
                      ____________________________________________________________
consensus CTTATAGACGTGCTGACTCTCCACCTACAAGACGGAGGCTTACACCTCCACCAAGAGGAG
 
. : . : . : . : . : . :
JMFN044L06- GGCGTTCACCCTCTCCACCAAGGCGTTACCGGTCACCACCTAGGGGGTCTCCTAGAAGAA
JMFN039K20- GGCGTTCACCCTCTCCACCAAGGCGTTACCGGTCACCACCTAGGGGGTCTCCTAGAAGAA
rJMSF019E18+ GGCGTTCACCCTCTCCACCAAGGCGTTACCGGTCACCACCTAGGGGGTCTCCTAGAAGAA
rJMSF028I12+ GGCGTTCACCCTCTCCACCAAGGCGTTACCGGTCACCACCTAGGGGGTCTCCTAGAAGAA
                      ____________________________________________________________
consensus GGCGTTCACCCTCTCCACCAAGGCGTTACCGGTCACCACCTAGGGGGTCTCCTAGAAGAA
 
. : . : . : . : . : . :
JMFN044L06- TCCGTGGAAGTCCTCTTCGAAGACGTTCTCCCCCTCCTCCTCCAAGAAGACGTTCACCCC
JMFN039K20- TCCGTGGAAGTCCTCTTCGAAGACGTTCTCCCCCTCCTCCTCCAAGAAGACGTTCACCCC
rJMSF019E18+ TCCGTGGAAGTCCTCTTCGAAGACGTTCTCCCCCTCCTCCTCCAAGAAGACGTTCACCCC
rJMSF028I12+ TCCGTGGAAGTCCTCTTCGAAGACGTTCTCCCCCTCCTCCTCCAAGAAGACGTTCACCCC
                      ____________________________________________________________
consensus TCCGTGGAAGTCCTCTTCGAAGACGTTCTCCCCCTCCTCCTCCAAGAAGACGTTCACCCC
 
. : . : . : . : . : . :
JMFN044L06- GGCGAGCACGTAGTCCTCCCAGACGGTCTCCCATCGGTCGCAGACGTAGCCGCTCTCCTA
JMFN039K20- GGCGAGCACGTATTCCTCCCAGACGGTCTCCCATCGGTCGCAGACGTAGCCGCTCTCCTA
rJMSF019E18+ GGCGAGCACGTAGTCCTCCCAGACGGTCTCCCATCGGTCGCAGACGTAGCCGCTCTCCTA
rJMSF028I12+ GGCGAGCACGTAGTCCTCCCAGACGGTCTCCCATCGGTCGCAGACGTAGCCGCTCTCCTA
                      ____________________________________________________________
consensus GGCGAGCACGTAGTCCTCCCAGACGGTCTCCCATCGGTCGCAGACGTAGCCGCTCTCCTA
 
. : . : . : . : . : . :
JMFN044L06- TAAGGAGGCCTGTACGATCACGTTCGAGATCTATTTCTCCTAGGAGAGCAAGAGGAGGAC
JMFN039K20- TAAGGAGGCCTGTACGATCACGTTCGAGATCTATTTCTCCTAGGAGAGCAAGAGGAGGAC
rJMSF019E18+ TAAGGAGGCCTGTACGATCACGTTCGAGATCTATTTCTCCTAGGAGAGCAAGAGGAGGAC
rJMSF028I12+ TAAGGAGGCCTGTACGATCACGTTCGAGATCTATTTCTCCTAGGAGAGCAAGAGGAGGAC
                      ____________________________________________________________
consensus TAAGGAGGCCTGTACGATCACGTTCGAGATCTATTTCTCCTAGGAGAGCAAGAGGAGGAC
 
. : . : . : . : . : . :
JMFN044L06- CACCTTCTAGACGCGGGAGGTCATCATCTTACTCCTCATCACCCAGTGCTAGGAAGGGAC
JMFN039K20- CACCTTCTAGACGCGGGAGGTCATCATCTTACTCCTCATCACCCAGTGCTAGGAAGGGAC
rJMSF019E18+ CACCTTCTAGACGCGGGAGGTCATCATCTTACTCCTCATCACCCAGTGCTAGGAAGGGAC
rJMSF028I12+ CACCTTCTAGACGCGGGAGGTCATCATCTTACTCCTCATCACCCAGTGCTAGGAAGGGAC
                      ____________________________________________________________
consensus CACCTTCTAGACGCGGGAGGTCATCATCTTACTCCTCATCACCCAGTGCTAGGAAGGGAC
 
. : . : . : . : . : . :
JMFN044L06- CACGCAAAATATCTAGGAGTCGCAGTCCTAAAAGGCCTTTAAGAGGAAAAAGCCCCAGCA
JMFN039K20- CACGCAAAATATCTAGGAGTCGCAGTCCTAAAAGGCCTTTAAGAGGAAAAAGCCCCAGCA
rJMSF019E18+ CACGCAAAATATCTAGGAGTCGCAGTCCTAAAAGGCCTTTAAGAGGAAAAAGCCCCAGCA
rJMSF028I12+ CACGCAAAATATCTAGGAGTCGCAGTCCTAAAAGGCCTTTAAGAGGAAAAAGCCCCAGCA
                      ____________________________________________________________
consensus CACGCAAAATATCTAGGAGTCGCAGTCCTAAAAGGCCTTTAAGAGGAAAAAGCCCCAGCA
 
. : . : . : . : . : . :
JMFN044L06- ACAGTAGCAGCAGTGGGTCCCCACCACCATCACGGAAGCCCTAGGGTGGAAGTTAGTAGT
JMFN039K20- ACAGTAGCAGCAGTGGGTCCCCACCACCATCACGGAAGCCCTAGGGTGGAAGTTAGTAGT
rJMSF019E18+ ACAGTAGCAGCAGTGGGTCCCCACCACCATCACGGAAGCCCTAGGGTGGAAGTTAGTAGT
rJMSF028I12+ ACAGTAGCAGCAGTGGGTCCCCACCACCATCACGGAAGCCCTAGGGTGGAAGTTAGTAGT
                      ____________________________________________________________
consensus ACAGTAGCAGCAGTGGGTCCCCACCACCATCACGGAAGCCCTAGGGTGGAAGTTAGTAGT
 
. : . : . : . : . : . :
JMFN044L06- AAATTTCATGTACCGGTTGGCATCTGGATATGATCTA
JMFN039K20- AAATTTCATGTACCGGTTGGCATCTGGATATGATCTATAAGAGTTTTAGCTTAATTGTGT
rJMSF019E18+ AAATTTCATGTACCGGTTGGCATCTGGATATGATCTATAAGAGTTTTAGCTTAATTGTGT
rJMSF028I12+ AAATTTCATGTACCGGTTGGCATCTGGATATGATCTATAAGAGTTTTAGCTTAATTGTGT
                      ____________________________________________________________
consensus AAATTTCATGTACCGGTTGGCATCTGGATATGATCTATAAGAGTTTTAGCTTAATTGTGT
 
. : . : . : . : . : . :
JMFN039K20- ATCCTCTGTAATGTGAAGTTGATTGTTGGATGTGGAATCTGTCTATCATGGTATGTCTTT
rJMSF019E18+ ATCCTCTGTAATGTGAAGTTGATTGTTGGATGTGGAATCTGTCTATCATGGTATGTCTTT
rJMSF028I12+ ATCCTCTGTAATGTGAAGTTGATTGTTGGATGTGGAATCTGTCTATCATGGTATGTCTTT
                      ____________________________________________________________
consensus ATCCTCTGTAATGTGAAGTTGATTGTTGGATGTGGAATCTGTCTATCATGGTATGTCTTT
 
. : . : . : . : . : . :
JMFN039K20- TCATTAGTTTGAGTGTGAGATAATTTGAGCT
rJMSF019E18+ TCATTAGTTTGAGTGTGAGATAATTTGAGCT
rJMSF028I12+ TCATTAGTTTGAGTGTGAGATAATTTGAGCTTAAAAGAACCAGACATTTGCATAGGATGG
                      ____________________________________________________________
consensus TCATTAGTTTGAGTGTGAGATAATTTGAGCTTAAAAGAACCAGACATTTGCATAGGATGG