Previous Contig 012610:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028H24Sequence671012610 (2)pir|H96576|H965764e-67hypothetical protein F22G10.17 [imported] - Arabidopsis thaliana>gb:AE005173_893661012610 (2)gb:AY087664_15726939e-64Arabidopsis thaliana clone 3748 mRNA, complete sequence.>gb:AK117314_1815354 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028H24- GGTCAATGGCTGCTCGCAGCATAATAACTAGTAGCGTGAGCTCACCGGTTAACCTTTCA
                      ____________________________________________________________
consensus GGTCAATGGCTGCTCGCAGCATAATAACTAGTAGCGTGAGCTCACCGGTTAACCTTTCA
 
. : . : . : . : . : . :
JMSF028H24- TCCAAATCCCTTTCTGGGTCGAATAGCAAACCTCTATTTTCTTTAGCTTTTGGATCGTTT
                      ____________________________________________________________
consensus TCCAAATCCCTTTCTGGGTCGAATAGCAAACCTCTATTTTCTTTAGCTTTTGGATCGTTT
 
. : . : . : . : . : . :
JMSF028H24- AACAAACCAAGAAATAAAGTTTCCTTCTTGATTCGTGGTATGGGCTCCTCTGCTTCTTCA
rJMSF028H24+ A
                      ____________________________________________________________
consensus AACAAACCAAGAAATAAAGTTTCCTTCTTGATTCGTGGTATGGGCTCCTCTGCTTCTTCA
 
. : . : . : . : . : . :
JMSF028H24- CCCAAACCAGACAGCGCTCAAGGTCTCTCTCTCTCTCTCTCTCTCTACATACAAAAGGAT
rJMSF028H24+ CCCAAACCAGACAGCGCTCAAGGTCTCTCTCTCTCTCTCTCTCTCTACATACAAAAGGAT
                      ____________________________________________________________
consensus CCCAAACCAGACAGCGCTCAAGGTCTCTCTCTCTCTCTCTCTCTCTACATACAAAAGGAT
 
. : . : . : . : . : . :
JMSF028H24- TTCTCATTGTGTTTATGATTCCTTGCATTTTTTTTATGCAGAGGTCAGCAATAAAGATTT
rJMSF028H24+ TTCTCATTGTGTTTATGATTCCTTGCATTTTTTTTATGCAGAGGTCAGCAATAAAGATTT
                      ____________________________________________________________
consensus TTCTCATTGTGTTTATGATTCCTTGCATTTTTTTTATGCAGAGGTCAGCAATAAAGATTT
 
. : . : . : . : . : . :
JMSF028H24- TAGCTCAGTTAGTGATGAGGAGTGGAAGAAGCGGCTGACAGGACAACAATTTTACATTAC
rJMSF028H24+ TAGCTCAGTTAGTGATGAGGAGTGGAAGAAGCGGCTGACAGGACAACAATTTTACATTAC
                      ____________________________________________________________
consensus TAGCTCAGTTAGTGATGAGGAGTGGAAGAAGCGGCTGACAGGACAACAATTTTACATTAC
 
. : . : . : . : . : . :
JMSF028H24- ACGGCAAAAGGGTACTGAGAGGGCTTTTACTGGGGAATATTGGGACACCAAAACTCCCGG
rJMSF028H24+ ACGGCAAAAGGGTACTGAGAGGGCTTTTACTGGGGAATATTGGGACACCAAAACTCCCGG
                      ____________________________________________________________
consensus ACGGCAAAAGGGTACTGAGAGGGCTTTTACTGGGGAATATTGGGACACCAAAACTCCCGG
 
. : . : . : . : . : . :
JMSF028H24- CACTTATCATTGCGTTTGTTGTGACACTCCACTCTTCGAATCATCCACCAAGTTTGATAG
rJMSF028H24+ CACTTATCATTGCGTTTGTTGTGACACTCCACTCTTCGAATCATCCACCAAGTTTGATAG
                      ____________________________________________________________
consensus CACTTATCATTGCGTTTGTTGTGACACTCCACTCTTCGAATCATCCACCAAGTTTGATAG
 
. : . : . : . : . : . :
JMSF028H24- TGGAACCGGGTGGCCATCGTATTACAAGCCTGTTGGAAACAATGTGAAATCAAAGTTAGA
rJMSF028H24+ TGGAACCGGGTGGCCATCGTATTACAAGCCTGTTGGAAACAATGTGAAATCAAAGTTAGA
                      ____________________________________________________________
consensus TGGAACCGGGTGGCCATCGTATTACAAGCCTGTTGGAAACAATGTGAAATCAAAGTTAGA
 
. : . : . : . : . : . :
JMSF028H24- CTTGTCCATCATTTTCATGCCTCGCCAGGAAGTTTTGTGTGCAGCTTGTGATGCTCATCT
rJMSF028H24+ CTTGTCCATCATTTTCATGCCTCGCCAGGAAGTTTTGTGTGCAGCTTGTGATGCTCATCT
                      ____________________________________________________________
consensus CTTGTCCATCATTTTCATGCCTCGCCAGGAAGTTTTGTGTGCAGCTTGTGATGCTCATCT
 
. : . : . : . : . : . :
JMSF028H24- AGGTCATGTATTTGACGATGGCCCCGAACCTACTGGAAAACGCTACTGCATCAATAGTGC
rJMSF028H24+ AGGTCATGTATTTGACGATGGCCCCGAACCTACTGGAAAACGCTACTGCATCAATAGTGC
                      ____________________________________________________________
consensus AGGTCATGTATTTGACGATGGCCCCGAACCTACTGGAAAACGCTACTGCATCAATAGTGC
 
. : . : . : . : . : . :
JMSF028H24- TGCCTTGAAATT
rJMSF028H24+ TGCCTTGAAATTGAAACCAAAATAGGAAGTATCAAAGGGTGGACAGGAAGGATGTGAATC
                      ____________________________________________________________
consensus TGCCTTGAAATTGAAACCAAAATAGGAAGTATCAAAGGGTGGACAGGAAGGATGTGAATC
 
. : . : . : . : . : . :
rJMSF028H24+ TGTGGCATTAAAGATGTATGCCTGTAATTTTCCAGCTTTGCTTGGTGACTTCAATGTACC
                      ____________________________________________________________
consensus TGTGGCATTAAAGATGTATGCCTGTAATTTTCCAGCTTTGCTTGGTGACTTCAATGTACC
 
. : . : . : . : . : . :
rJMSF028H24+ TCAGTTGTTTGAGTCATTGTATATGTAACATTCAACTTCTTATGGATGAACACACATTTA
                      ____________________________________________________________
consensus TCAGTTGTTTGAGTCATTGTATATGTAACATTCAACTTCTTATGGATGAACACACATTTA