Previous Contig 012609:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001K15Sequence217004337 (2)642012609 (2)gb:AC107207_17383604e-51Oryza sativa chromosome 3 BAC OSJNBb0106M04 genomic sequence, complete sequence.
JMSF028H16Sequence672004337 (2)pir|B96530|B965306e-37Similar to CCS1 [imported] - Arabidopsis thaliana>gb:AE005173_892873 Arabidopsis722012609 (2)pir|B96530|B965302e-64Similar to CCS1 [imported] - Arabidopsis thaliana>gb:AE005173_892873 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028H16+ CT
                      ____________________________________________________________
consensus CT
 
. : . : . : . : . : . :
rJMSF028H16+ ATGGCGCCTCTAAAGATCAATGGAGACAAGAAGTTGTTCGGTACATTCCTGCCTATAGGT
                      ____________________________________________________________
consensus ATGGCGCCTCTAAAGATCAATGGAGACAAGAAGTTGTTCGGTACATTCCTGCCTATAGGT
 
. : . : . : . : . : . :
rJMSF001K15+ ATGTCAAGGGAATATCAATGTTAGCGCGTGACTTGCAGTCCATT
rJMSF028H16+ GATACTGATTCTCCTGATGTCAAGGGAATATCAATGTTAGCGCGTGACTTGCAGTCCATT
                      ____________________________________________________________
consensus GATACTGATTCTCCTGATGTCAAGGGAATATCAATGTTAGCGCGTGACTTGCAGTCCATT
 
. : . : . : . : . : . :
rJMSF001K15+ ATCCTNTATGATAAAGAAGGGAAATTTGTTGGAGTCAGGCGGCCCAACTCTAAGCTTCCG
rJMSF028H16+ ATCCTTTATGATAAAGAAGGGAAATTTGTTGGAGTCAGGCGGCCCAACTCTAAGCTTCCG
                      ____________________________________________________________
consensus ATCCTTTATGATAAAGAAGGGAAATTTGTTGGAGTCAGGCGGCCCAACTCTAAGCTTCCG
 
. : . : . : . : . : . :
rJMSF001K15+ ATTGAGATTGATGGAACCAAAATTCTAATAGTAGATGCAATTGGTAGCACTGGCCTTGAC
rJMSF028H16+ ATTGAGATTGATGGAACCAAAATTCTAATAGTAGATGCAATTGGTAGCACTGGCCTTGAC
                      ____________________________________________________________
consensus ATTGAGATTGATGGAACCAAAATTCTAATAGTAGATGCAATTGGTAGCACTGGCCTTGAC
 
. : . : . : . : . : . :
rJMSF001K15+ CTGAAGAGCGACCCAGGGGTGCCAATCGTGTATGCGGGTTTTGGAGCTTTAATGCTTACG
rJMSF028H16+ CTGAAGAGCGACCCAGGGGTGCCAATCGTGTATGCGGGTTTTGGAGCTTTAATGCTTACG
                      ____________________________________________________________
consensus CTGAAGAGCGACCCAGGGGTGCCAATCGTGTATGCGGGTTTTGGAGCTTTAATGCTTACG
 
. : . : . : . : . : . :
rJMSF001K15+ ACGTTCATCAGCTTCTTGTCACACAGTCAGATATGGGCGTTACAAGATGGAACAATGGTG
rJMSF028H16+ ACGTTCATCAGCTTCTTGTCACACAGTCAGATATGGGCGTTACAAGATGGAACAATGGTG
                      ____________________________________________________________
consensus ACGTTCATCAGCTTCTTGTCACACAGTCAGATATGGGCGTTACAAGATGGAACAATGGTG
 
. : . : . : . : . : . :
rJMSF001K15+ GTTGTGGGAGGAAAGACTAACCGGGCGAAAGGTGAATTTCCAGATGCAATAAGCAGCTTG
rJMSF028H16+ GTTGTGGGAGGAAAGACTAACCGGGCGAAAGGTGAATTTCCAGATGCAATAAGCAGCTTG
                      ____________________________________________________________
consensus GTTGTGGGAGGAAAGACTAACCGGGCGAAAGGTGAATTTCCAGATGCAATAAGCAGCTTG
 
. : . : . : . : . : . :
rJMSF001K15+ CTTGATCAAGTCCCTGAAATAGTTGAATCATCTCCTTCCAAAGAATCAAATGGTCTCAGT
rJMSF028H16+ CTTGATCAAGTCCCTGAAATAGTTGAATCATCTCCTTCCAAAGAATCAAATGGTCTCAGT
                      ____________________________________________________________
consensus CTTGATCAAGTCCCTGAAATAGTTGAATCATCTCCTTCCAAAGAATCAAATGGTCTCAGT
 
. : . : . : . : . : . :
rJMSF001K15+ CTCTGAGGCATTTACTTGGATCAAAGAGTATTACATAACATAGTTCGACTCCACGGATGA
rJMSF028H16+ CTCTGAGGCATTTACTTGGATCAAAGAGTATTACATAACATAGTTCGACTCCACGGATGA
                      ____________________________________________________________
consensus CTCTGAGGCATTTACTTGGATCAAAGAGTATTACATAACATAGTTCGACTCCACGGATGA
 
. : . : . : . : . : . :
rJMSF001K15+ TTCAGTCCGAGGAGAAACCAACACAAGTTGCCAGGAAAACTCTTCAATGATGGTTTGGTT
rJMSF028H16+ TTCAGTCCGAGGAGAAACCAACACAAGTTGCCAGGAAAACTCTTCAATGATGGTTTGGTT
                      ____________________________________________________________
consensus TTCAGTCCGAGGAGAAACCAACACAAGTTGCCAGGAAAACTCTTCAATGATGGTTTGGTT
 
. : . : . : . : . : . :
rJMSF001K15+ AGAACTTATTCCATTGATTCCTTGTAGATCGGATTCAGAGCCTTCCAAGAATCATAAATT
rJMSF028H16+ AGAACTTATTCCATTGATTCCTTGTAGATCGGATTCAGAGCCTTCCAAGAATCATAAATT
                      ____________________________________________________________
consensus AGAACTTATTCCATTGATTCCTTGTAGATCGGATTCAGAGCCTTCCAAGAATCATAAATT
 
. : . : . : . : . : . :
rJMSF001K15+ TCTGCTCTGTAGATATAATTGTACTTGTGTATA-CAGGAGAAAATTCATAGATAC
rJMSF028H16+ TCTGCTCTGTAGATATAATTGTACTTGTGTATACCAGGAGAAAATTCATAGATACCATGA
                      ____________________________________________________________
consensus TCTGCTCTGTAGATATAATTGTACTTGTGTATACCAGGAGAAAATTCATAGATACCATGA