Previous Contig 012607:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS126B02Sequence365012607 (2)
JMSF028H10Sequence638004117 (4)pir|T49915|T499151e-14pre-mRNA splicing factor ATP-dependent RNA helicase-like protein - Arabidopsis t764012607 (2)gb:AP003815_18337422e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126B02+ TA
                      ____________________________________________________________
consensus TA
 
. : . : . : . : . : . :
JMFS126B02+ GTACCTTATGTCAGTGATTCATCCACTGTATAATGATTGGTTAAAAATGGCATTTACAAA
                      ____________________________________________________________
consensus GTACCTTATGTCAGTGATTCATCCACTGTATAATGATTGGTTAAAAATGGCATTTACAAA
 
. : . : . : . : . : . :
JMFS126B02+ AACACACATCTATTACAAATTCAGTTCCCTGAGTTGATTCATAGTTAAAAACTGTACTAA
rJMSF028H10- AATTCAGTTCCCTGAGTTGATTCATAGTTAAAAACTGTACTAA
                      ____________________________________________________________
consensus AACACACATCTATTACAAATTCAGTTCCCTGAGTTGATTCATAGTTAAAAACTGTACTAA
 
. : . : . : . : . : . :
JMFS126B02+ CAGTTGAATACTACCAAGTGTAATGATCCTTCCTTCCTTACACAACTTACAAGCCGTCAA
rJMSF028H10- CAGTTGAATACTACCAAGTGTAATGATCCTTCCTTCCTTACACAACTTACAAGCCGTCAA
                      ____________________________________________________________
consensus CAGTTGAATACTACCAAGTGTAATGATCCTTCCTTCCTTACACAACTTACAAGCCGTCAA
 
. : . : . : . : . : . :
JMFS126B02+ TGAATACATGTCAAAAATCATCACATGAAATGTTATACACTTACAGCCCAAGTTTCTTAG
rJMSF028H10- TGAATACATGTCAAAAATCATCACATGAAATGTTATACACTTACAGCCCAAGTTTCTTAG
                      ____________________________________________________________
consensus TGAATACATGTCAAAAATCATCACATGAAATGTTATACACTTACAGCCCAAGTTTCTTAG
 
. : . : . : . : . : . :
JMFS126B02+ GTCTAAGGTAAGTAGAAGTCTTGGGCTTCAACCCAGGCATTGAAACTTGTTGTTGCTGCC
rJMSF028H10- GTCTAAGGTAAGTAGAAGTCTTGGGCTTCAACCCAGGCATTGAAACTTGTTGTTGCTGCC
                      ____________________________________________________________
consensus GTCTAAGGTAAGTAGAAGTCTTGGGCTTCAACCCAGGCATTGAAACTTGTTGTTGCTGCC
 
. : . : . : . : . : . :
JMFS126B02+ TCTCCCTCTTCTTCCTCTCCTTCTCCTTGTTTCTTCTATCAATCTCTGCTTGCACCTTCC
rJMSF028H10- TCTCCCTCTTCTTCCTCTCCTTCTCCTTGTTTCTTCTATCAATCTCTGCTTGCACCTTCC
                      ____________________________________________________________
consensus TCTCCCTCTTCTTCCTCTCCTTCTCCTTGTTTCTTCTATCAATCTCTGCTTGCACCTTCC
 
. : . : . : . : . : . :
JMFS126B02+ TCA
rJMSF028H10- TCAAATTCTCCATTTCTTCTTCCATGGCGGTTTTTTCTTCCTTTTGCTTCTTTTTGTGTT
                      ____________________________________________________________
consensus TCAAATTCTCCATTTCTTCTTCCATGGCGGTTTTTTCTTCCTTTTGCTTCTTTTTGTGTT
 
. : . : . : . : . : . :
rJMSF028H10- CTAACATGGATGTATCCGACTCCTTGATAGAGAAAAACATGGGTCCCAGCTCCGCTAACC
                      ____________________________________________________________
consensus CTAACATGGATGTATCCGACTCCTTGATAGAGAAAAACATGGGTCCCAGCTCCGCTAACC
 
. : . : . : . : . : . :
rJMSF028H10- ACTGAGGCTACTGCGGTCACACACTGCATATACTCCTTCGTTGTTAAGATCAACTCGTGA
                      ____________________________________________________________
consensus ACTGAGGCTACTGCGGTCACACACTGCATATACTCCTTCGTTGTTAAGATCAACTCGTGA
 
. : . : . : . : . : . :
rJMSF028H10- TAAACCACGTAATCGGGTGTATAACCCAGCCCATACAGTGCACTAGTGGGATGCAGATGA
                      ____________________________________________________________
consensus TAAACCACGTAATCGGGTGTATAACCCAGCCCATACAGTGCACTAGTGGGATGCAGATGA
 
. : . : . : . : . : . :
rJMSF028H10- CATGGCATTCCATTCCTGCAATTCACATATTCACCCACCCCCTTGAGTCTAGCTGAATTA
                      ____________________________________________________________
consensus CATGGCATTCCATTCCTGCAATTCACATATTCACCCACCCCCTTGAGTCTAGCTGAATTA
 
. : . : . : . : . : . :
rJMSF028H10- TGAAAATATGCAGAACAGATTGCCTTTCTCACGATGTCCCAATCGGGGCCACATGAGGTA
                      ____________________________________________________________
consensus TGAAAATATGCAGAACAGATTGCCTTTCTCACGATGTCCCAATCGGGGCCACATGAGGTA
 
. : . : . : . : . : . :
rJMSF028H10- AGTGGAATTTTGAGGGTCTTCAGTATATCCAGCAGTTGAGATCTAACCTCCCTAGCTTTG
                      ____________________________________________________________
consensus AGTGGAATTTTGAGGGTCTTCAGTATATCCAGCAGTTGAGATCTAACCTCCCTAGCTTTG
 
. : . : . : . : . : . :
rJMSF028H10- CGCAAACCTTTGACGTGCAAGAAATGGTCATTACACCAATCACCTCGGTACTGGTTCGCC
                      ____________________________________________________________
consensus CGCAAACCTTTGACGTGCAAGAAATGGTCATTACACCAATCACCTCGGTACTGGTTCGCC