Previous Contig 012604:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014G06Sequence209012604 (3)
JMSF028H01Sequence658006527 (7)gb:AF249743_17807846e-81Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple210012604 (3)
JMSF039J23Sequence681006527 (7)gb:AF249743_17807847e-99Nicotiana tabacum heterotrimeric GTP-binding protein subunit beta 1 mRNA, comple178012604 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014G06+ GNAAGGGGNNNNTTTTTTNTTNCNAAAANNN
                      ____________________________________________________________
consensus GNAAGGGGNNNNTTTTTTNTTNCNAAAANNN
 
. : . : . : . : . : . :
rJMSF014G06+ GGGGGGNAAAAAAAAAAAAACCACTTTGCCCTTGGACATTTGATTTTCATAATAGGAAAA
rJMSF039J23+ AAAAAAAAAAAACCACTTTGCCCTTGGACATTTGATTTTCATAATAGGAAAA
rJMSF028H01+ AAAAAAAAAAAACCACTTTGCCCTTGGACATTTGATTTTCATAATAGGAAAA
                      ____________________________________________________________
consensus GGGGGGNAAAAAAAAAAAAACCACTTTGCCCTTGGACATTTGATTTTCATAATAGGAAAA
 
. : . : . : . : . : . :
rJMSF014G06+ ACTATTATGGTTTTTTGTAAGGTTTGTGCTAGATTTGTTCTGCAATAATAGGTTATAGTG
rJMSF039J23+ ACTATTATGGTTTTTTGTAAGGTTTGTGCTAGATTTGTTCTGCAATAATAGGTTATAGTG
rJMSF028H01+ ACTATTATGGTTTTTTGTAAGGTTTGTGCTAGATTTGTTCTGCAATAATAGGTTATAGTG
                      ____________________________________________________________
consensus ACTATTATGGTTTTTTGTAAGGTTTGTGCTAGATTTGTTCTGCAATAATAGGTTATAGTG
 
. : . : . : . : . : . :
rJMSF014G06+ TTGTGCCCAAATTTGGAGTATTGAAGAAAGCCTTTCCCATGTAAAACGTT
rJMSF039J23+ TTGTGCCCAAATTTGGAGTATTGAAGAAAGCCTTTCCCATGTAAAACGTT
rJMSF028H01+ TTGTGCCCAAATTTGGAGTATTGAAGAAAGCCTTTCCCATGTAAAACGTTTATTGAAGTT
                      ____________________________________________________________
consensus TTGTGCCCAAATTTGGAGTATTGAAGAAAGCCTTTCCCATGTAAAACGTTTATTGAAGTT