Previous Contig 012603:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012O21Sequence310000114 (10)716012603 (2)gb:AY371292_16030551e-27Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.
JMSF028G17Sequence680000114 (10)gb:AY371292_16030554e-24Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.694012603 (2)gb:AY371292_16030554e-28Mesembryanthemum crystallinum early flowering 3 (ELF3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012O21+ TCCTGCA
                      ____________________________________________________________
consensus TCCTGCA
 
. : . : . : . : . : . :
rJMSF012O21+ TATGGACTCCCAACTTCTCAATATCACTATCAAGGAATGGGTGATCCGTTTGCCCCTCCT
rJMSF028G17+ CTATCAAGGAATGGGTGATCCGTTTGCCCCTCCT
                      ____________________________________________________________
consensus TATGGACTCCCAACTTCTCAATATCACTATCAAGGAATGGGTGATCCGTTTGCCCCTCCT
 
. : . : . : . : . : . :
rJMSF012O21+ ATCGGTCATGGCTATTTCCATCCATATGGTATGCCGGTAATGAACTCTGCTGTCTCAACA
rJMSF028G17+ ATCGGTCATGGCTATTTCCCTCCATATGGTATGCCGGTAATGAACTCTGCTGTCTCAACA
                      ____________________________________________________________
consensus ATCGGTCATGGCTATTTCCCTCCATATGGTATGCCGGTAATGAACTCTGCTGTCTCAACA
 
. : . : . : . : . : . :
rJMSF012O21+ TCAGCTGTTGAACAGATGAACTCATTTACTCGAACGGGTTCTCAAGCTCAGGTATCAGGT
rJMSF028G17+ TCAGCTGTTGAACAGATGAACTCATTTACTCGAACGGGTTCTCAAGCTCAGGTATCAGGT
                      ____________________________________________________________
consensus TCAGCTGTTGAACAGATGAACTCATTTACTCGAACGGGTTCTCAAGCTCAGGTATCAGGT
 
. : . : . : . : . : . :
rJMSF012O21+ GGGGGGGTGAACTTAAATGTTCAACATCAGAACTCATGCAACATGCCAAGCCAGAAGAAT
rJMSF028G17+ GGGGGGGTGAACTTAAATGTTCAACATCAGAACTCATGCAACATGCCAAGCCAGAAGAAT
                      ____________________________________________________________
consensus GGGGGGGTGAACTTAAATGTTCAACATCAGAACTCATGCAACATGCCAAGCCAGAAGAAT
 
. : . : . : . : . : . :
rJMSF012O21+ GGGGATGCTGATGTTTCCGACGCTCACAGATTGCATGCTTGTAAAGATAATGAGATACAA
rJMSF028G17+ GGGGATGCTGATGTTTCCGACGCTCACAGATTGCATGCTTGTAAAGATAATGAGATACAA
                      ____________________________________________________________
consensus GGGGATGCTGATGTTTCCGACGCTCACAGATTGCATGCTTGTAAAGATAATGAGATACAA
 
. : . : . : . : . : . :
rJMSF012O21+ GCTAGCTGTGCTAGTAGTCCAAGTGTAAGAGCACCGGGCGTGACAGTAAGTGGTCCCATG
rJMSF028G17+ GCTAGCTGTGCTAGTAGTCCAAGTGTAAGAGCACCGGGCGTGACAGTAAGTGGTCCCATG
                      ____________________________________________________________
consensus GCTAGCTGTGCTAGTAGTCCAAGTGTAAGAGCACCGGGCGTGACAGTAAGTGGTCCCATG
 
. : . : . : . : . : . :
rJMSF012O21+ GAAGGAAGAAGTGTGCTTCCTCTATTTCCCACATCCCCAGTTGTCAACATCGTCGATGCC
rJMSF028G17+ GAAGGAAGAAGTGTGCTTCCTCTATTTCCCACATCCCCAGTTGTCAACATCGTCGATGCC
                      ____________________________________________________________
consensus GAAGGAAGAAGTGTGCTTCCTCTATTTCCCACATCCCCAGTTGTCAACATCGTCGATGCC
 
. : . : . : . : . : . :
rJMSF012O21+ AGTCAGCCTCCTGATACTGGTCACCCTGCTAGGGTAATACGAGTTGTACCTCATAATGCT
rJMSF028G17+ AGTCAGCCTCCTGATACTGGTCACCCTGCTAGGGTAATACGAGTTGTACCTCATAATGCT
                      ____________________________________________________________
consensus AGTCAGCCTCCTGATACTGGTCACCCTGCTAGGGTAATACGAGTTGTACCTCATAATGCT
 
. : . : . : . : . : . :
rJMSF012O21+ AGATCTGCATCTGAATCAGCTGCTCGGATCTTTCAATCTATACAAAAGGAGAGGAAGCAA
rJMSF028G17+ AGATCTGCATCTGAATCAGCTGCTCGGATCTTTCAATCTATACAAAAGGAGAGGAAGCAA
                      ____________________________________________________________
consensus AGATCTGCATCTGAATCAGCTGCTCGGATCTTTCAATCTATACAAAAGGAGAGGAAGCAA
 
. : . : . : . : . : . :
rJMSF012O21+ TGACTCTAGTGTAACACATAAATAGGTAAGCAGCTGGTGGTGGCGGCTTGGAGGAGTGTA
rJMSF028G17+ TGACTCTAGTGTAACACATAAATAGGTAAGCAGCTGGTGGTGGCGGCTTGGAGGAGTGTA
                      ____________________________________________________________
consensus TGACTCTAGTGTAACACATAAATAGGTAAGCAGCTGGTGGTGGCGGCTTGGAGGAGTGTA
 
. : . : . : . : . : . :
rJMSF012O21+ CGTACTTGACCATTTGCCCATCCAGCAAATTGGTCAGTTGTCTTAAACATTTTGGCTGCT
rJMSF028G17+ CGTACTTGACCATTTGCCCATCCAGCAAATTGGTCAGTTGTCTTAAACATTTTGGCTGCT
                      ____________________________________________________________
consensus CGTACTTGACCATTTGCCCATCCAGCAAATTGGTCAGTTGTCTTAAACATTTTGGCTGCT
 
. : . : . : . : . : . :
rJMSF012O21+ ATGTAGTAGTAACTGAATTTTGTGTAGCAGACCAGTCCTAATGTAATGC
rJMSF028G17+ ATGTAGTAGTAACTGAATTTTGTGTAGCAGACCAGTCCTAATGTAATGCATGCATAGATT
                      ____________________________________________________________
consensus ATGTAGTAGTAACTGAATTTTGTGTAGCAGACCAGTCCTAATGTAATGCATGCATAGATT