Previous Contig 012602:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028G16Sequence646006523 (2)gb:AY136344_15818456e-45Arabidopsis thaliana putative protein (At5g67290) mRNA, complete cds.>gb:BT00016780012602 (2)gb:AY136344_15818451e-85Arabidopsis thaliana putative protein (At5g67290) mRNA, complete cds.>gb:BT00016
JMSF029J01Sequence670006523 (2)gb:AY136344_15818459e-46Arabidopsis thaliana putative protein (At5g67290) mRNA, complete cds.>gb:BT00016722012602 (2)gb:AY136344_15818457e-80Arabidopsis thaliana putative protein (At5g67290) mRNA, complete cds.>gb:BT00016

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028G16+ GTGGTGATCGGTAAATTAGAGAGAATTGAGGCGGCGGAGGGGAGAGCCACGGCGGTGGTG
                      ____________________________________________________________
consensus GTGGTGATCGGTAAATTAGAGAGAATTGAGGCGGCGGAGGGGAGAGCCACGGCGGTGGTG
 
. : . : . : . : . : . :
rJMSF028G16+ CTGGAAGGAGGGAGACAGATAGAAACCGACGCTGTTGTCTTGGCTCTTGGGCCATGGACT
                      ____________________________________________________________
consensus CTGGAAGGAGGGAGACAGATAGAAACCGACGCTGTTGTCTTGGCTCTTGGGCCATGGACT
 
. : . : . : . : . : . :
rJMSF028G16+ AGCAAATTGAGCCTTTTGAATTCCATTTTCAGGGTATATGGGCTTAAGGCCCATAGCATT
                      ____________________________________________________________
consensus AGCAAATTGAGCCTTTTGAATTCCATTTTCAGGGTATATGGGCTTAAGGCCCATAGCATT
 
. : . : . : . : . : . :
rJMSF028G16+ GTCTTGGAGCCCAAAGCTCCTGATTCAATAACACTCCATGCATTGTTTCTTAGTTACTAC
                      ____________________________________________________________
consensus GTCTTGGAGCCCAAAGCTCCTGATTCAATAACACTCCATGCATTGTTTCTTAGTTACTAC
 
. : . : . : . : . : . :
rJMSF029J01+ ACAGGGGAGGTA
rJMSF028G16+ CCGGCCCAAGGTGGCGGCCCAATGGATCCAGAAGTGTATCCTCGTCCCACAGGGGAGGTA
                      ____________________________________________________________
consensus CCGGCCCAAGGTGGCGGCCCAATGGATCCAGAAGTGTATCCTCGTCCCACAGGGGAGGTA
 
. : . : . : . : . : . :
rJMSF029J01+ TATGTATGCGGAATGTCAGCAAAGGCAGAGGTCCCCGACGATCCAGAGCAGATAGCTCCG
rJMSF028G16+ TATGTATGCGGAATGTCAGCAAAGGCAGAGGTCCCCGACGATCCAGAGCAGATAGCTCCG
                      ____________________________________________________________
consensus TATGTATGCGGAATGTCAGCAAAGGCAGAGGTCCCCGACGATCCAGAGCAGATAGCTCCG
 
. : . : . : . : . : . :
rJMSF029J01+ GTCCCGGAATCAATTGCGGTGCTTAAGAGAGTAGCCGGAAATGTGTCAAGCCATTTGGTG
rJMSF028G16+ GTCCCGGAATCAATTGCGGTGCTTAAGAGAGTAGCCGGAAATGTGTCAAGCCATTTGGTG
                      ____________________________________________________________
consensus GTCCCGGAATCAATTGCGGTGCTTAAGAGAGTAGCCGGAAATGTGTCAAGCCATTTGGTG
 
. : . : . : . : . : . :
rJMSF029J01+ GAAGGGGAAGCGGCGGTGAAGGCGGAGCAATCCTGCTTCCTGCCTTGCACCGATGATAGC
rJMSF028G16+ GAAGGGGAAGCGGCGGTGAAGGCGGAGCAATCCTGCTTCCTGCCTTGCACCGATGATAGC
                      ____________________________________________________________
consensus GAAGGGGAAGCGGCGGTGAAGGCGGAGCAATCCTGCTTCCTGCCTTGCACCGATGATAGC
 
. : . : . : . : . : . :
rJMSF029J01+ GTGCCGGTTATCGGCGAAGTTCCCGGCATGAAGGGATGTTACGTTGCGACTGGCCATAGC
rJMSF028G16+ GTGCCGGTTATCGGCGAAGTTCCCGGCATGAAGGGATGTTACGTTGCGACTGGCCATAGC
                      ____________________________________________________________
consensus GTGCCGGTTATCGGCGAAGTTCCCGGCATGAAGGGATGTTACGTTGCGACTGGCCATAGC
 
. : . : . : . : . : . :
rJMSF029J01+ TGTTGGGGTATCCTAAATGGCCCTGCCACTGGTGCTTCCATGGCGGAACTTGTGATGGAT
rJMSF028G16+ TGTTGGGGTATCCTAAATGGCCCTGCCACTGGTGCTTCCATGGCGGAACTTGTGATGGAT
                      ____________________________________________________________
consensus TGTTGGGGTATCCTAAATGGCCCTGCCACTGGTGCTTCCATGGCGGAACTTGTGATGGAT
 
. : . : . : . : . : . :
rJMSF029J01+ GGTCGATCTAGCATCGTTGATCTCAGCGCATTTAGTCCGTCACGATTTGTTCGCGCTGCC
rJMSF028G16+ GGTCGATCTAGCATCGTTGATCTCAGCGCATTTAGTCCGTCACGATTTGTTCGCGCTGCC
                      ____________________________________________________________
consensus GGTCGATCTAGCATCGTTGATCTCAGCGCATTTAGTCCGTCACGATTTGTTCGCGCTGCC
 
. : . : . : . : . : . :
rJMSF029J01+ AAGTCCTAGAACGAACTTTTGGTGTGTGTGTATATATATATATATTGATCAAGAAGGTTT
rJMSF028G16+ AAGTCCTAGAACGAACTTTTGGTGTGTGTGTATATATATATATATTGATCAAGAAGGTTT
                      ____________________________________________________________
consensus AAGTCCTAGAACGAACTTTTGGTGTGTGTGTATATATATATATATTGATCAAGAAGGTTT
 
. : . : . : . : . : . :
rJMSF029J01+ CATTCTGATAGTACAGTGTTTCATTCTTGGATCCTAGAAAGCATGCTGAATAAAGTTCT
rJMSF028G16+ CATTCTGATAGTACAGTGTTTCATTCTTGGATCCTAGAAAGCATGCTGAATAAAGTTCTA
                      ____________________________________________________________
consensus CATTCTGATAGTACAGTGTTTCATTCTTGGATCCTAGAAAGCATGCTGAATAAAGTTCTA