Previous Contig 012601:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028G07Sequence652019515gb:AY086247_15713023e-18Arabidopsis thaliana clone 22963 mRNA, complete sequence.769012601 (2)gb:AY086247_15713024e-18Arabidopsis thaliana clone 22963 mRNA, complete sequence.
JMSF029G07Sequence136012601 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028G07+ AGTCCTCAAGTTCACCCCCTTCGCCCAGATTGATTTTGGATTATTTATT
                      ____________________________________________________________
consensus AGTCCTCAAGTTCACCCCCTTCGCCCAGATTGATTTTGGATTATTTATT
 
. : . : . : . : . : . :
rJMSF028G07+ TCCAGATTGTGTTATGAAATTATCTATTTCCAGATTGTAGATATTGATGCTGATACGCCC
                      ____________________________________________________________
consensus TCCAGATTGTGTTATGAAATTATCTATTTCCAGATTGTAGATATTGATGCTGATACGCCC
 
. : . : . : . : . : . :
rJMSF029G07+ CAGTTATGCAATTGCTNTNTTTGTG
rJMSF028G07+ AGTCCTCTTCGCCCAGTTTTCCAGTCCTCTTCGCCCAGTTATGCAATTGCTCTCTTTGTG
                      ____________________________________________________________
consensus AGTCCTCTTCGCCCAGTTTTCCAGTCCTCTTCGCCCAGTTATGCAATTGCTCTCTTTGTG
 
. : . : . : . : . : . :
rJMSF029G07+ GTCCATGGAATTGANCGTGGAGCAGCAGTAANTATTGANGAAGTGNTGTATGAGGGTGTT
rJMSF028G07+ GTCCATGGAATTGAACGTGGAGCAGCAGTAACTATTGATGAAGTGCTGTATGAGGGTGTT
                      ____________________________________________________________
consensus GTCCATGGAATTGAACGTGGAGCAGCAGTAACTATTGATGAAGTGCTGTATGAGGGTGTT
 
. : . : . : . : . : . :
rJMSF029G07+ GGAACACTAAAAGATAGATTNCCAATATTGNTGGTTTTGAATAAGAAGGAC
rJMSF028G07+ GGAACACTAAAAGATAGATTACCAATATTGCTGGTTTTGAATAAGAAGGACCTGATCAAA
                      ____________________________________________________________
consensus GGAACACTAAAAGATAGATTACCAATATTGCTGGTTTTGAATAAGAAGGACCTGATCAAA
 
. : . : . : . : . : . :
rJMSF028G07+ CCCGGTGAAATTGCAAAGAAACTTGAGGAAAAATTACTATAAGGAGGGTGAGTATATTTA
                      ____________________________________________________________
consensus CCCGGTGAAATTGCAAAGAAACTTGAGGAAAAATTACTATAAGGAGGGTGAGTATATTTA
 
. : . : . : . : . : . :
rJMSF028G07+ CCCCAAATTTGATGCAGTTGAAGCTTATAGAAGAGCCTTGAAGACCTGGGCAAGTTGGAT
                      ____________________________________________________________
consensus CCCCAAATTTGATGCAGTTGAAGCTTATAGAAGAGCCTTGAAGACCTGGGCAAGTTGGAT
 
. : . : . : . : . : . :
rJMSF028G07+ CGATGAACATCTGAAACAGAAAAAGTTGGTTTTCTATCGAGGGTACTCATATGCTCATTT
                      ____________________________________________________________
consensus CGATGAACATCTGAAACAGAAAAAGTTGGTTTTCTATCGAGGGTACTCATATGCTCATTT
 
. : . : . : . : . : . :
rJMSF028G07+ CAGGAACCCGAACTTGTTTAAGTTGCAGAGGATAATTATTATTCATCATCAAAAGAGAAG
                      ____________________________________________________________
consensus CAGGAACCCGAACTTGTTTAAGTTGCAGAGGATAATTATTATTCATCATCAAAAGAGAAG
 
. : . : . : . : . : . :
rJMSF028G07+ AGAAGAAGAAAGAACTCAAATGCAGGTTCAAATGCAAGCTCAAATTGCAAGTTTGATGGA
                      ____________________________________________________________
consensus AGAAGAAGAAAGAACTCAAATGCAGGTTCAAATGCAAGCTCAAATTGCAAGTTTGATGGA
 
. : . : . : . : . : . :
rJMSF028G07+ TGAGTTGCGTCGCCCAATGGCATGTTATCCAATCCAAGTACTCAAGCTCAACATTCGGCT
                      ____________________________________________________________
consensus TGAGTTGCGTCGCCCAATGGCATGTTATCCAATCCAAGTACTCAAGCTCAACATTCGGCT
 
. : . : . : . : . : . :
rJMSF028G07+ AATTCAAATGATGAAACCTTAGGAGATGATTTGATTAAGTTTATTAATATATTTGGTACT
                      ____________________________________________________________
consensus AATTCAAATGATGAAACCTTAGGAGATGATTTGATTAAGTTTATTAATATATTTGGTACT
 
. : . : . : . : . : . :
rJMSF028G07+ GGTTCTAATGATGTAACATTATACCACAACACTTTTGTTGTTGCTATTCACTTGAATGCT
                      ____________________________________________________________
consensus GGTTCTAATGATGTAACATTATACCACAACACTTTTGTTGTTGCTATTCACTTGAATGCT