Previous Contig 012593:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017I23Sequence363012593 (13)gb:AK175516_18175047e-10Arabidopsis thaliana mRNA for putative ribosomal protein S9, complete cds, clone625012593 (13)sp|P82278|RR9_SPIOL2e-5830S ribosomal protein S9, chloroplast precursor (Fragment).>gb:AF242547_1780189
JMFF021K21Sequence534012593 (13)gb:AK175516_18175042e-40Arabidopsis thaliana mRNA for putative ribosomal protein S9, complete cds, clone686012593 (13)sp|P82278|RR9_SPIOL2e-5930S ribosomal protein S9, chloroplast precursor (Fragment).>gb:AF242547_1780189
JMSF003J22Sequence329012593 (13)gb:AK175516_18175045e-05Arabidopsis thaliana mRNA for putative ribosomal protein S9, complete cds, clone702012593 (13)sp|Q9XJ27|RR9_ARATH7e-6030S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro
JMSF028D02Sequence610012593 (13)sp|Q9XJ27|RR9_ARATH2e-4330S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro739012593 (13)sp|P82278|RR9_SPIOL2e-5930S ribosomal protein S9, chloroplast precursor (Fragment).>gb:AF242547_1780189
JMSF039N24Sequence694020036gb:LES303345_16845593e-85Lycopersicon esculentum lateral suppressor gene, ORF1 and ORF2.776012593 (13)sp|Q9XJ27|RR9_ARATH9e-6030S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro
JMSF040K22Sequence609012593 (13)sp|Q9XJ27|RR9_ARATH2e-4330S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro807012593 (13)sp|Q9XJ27|RR9_ARATH9e-6030S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro
JMSF048P01Sequence621012593 (13)sp|Q9XJ27|RR9_ARATH3e-4130S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro718012593 (13)sp|Q9XJ27|RR9_ARATH7e-6030S ribosomal protein S9, chloroplast precursor.>pir|T52450|T52450 ribosomal pro

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048P01- TGGGCATCATCAAGTTATCATCAATTCCTGTTGCTATCCACTACTGATCCGCTTG
JMFF021K21- GTTGGTATCCACTACTGATCCGCTTG
JMFF017I23- GTTGGTATCCACTACTGATCCGCTTG
JMSF003J22- TTGCTATCCACTACTGATCCGCTTG
JMSF028D02- GTTGCTATCCACTACTGATCCGCTTG
JMSF040K22- GTTGCTATCCACTACTGATCCGCTTG
rJMSF040K22+ TG
                      ____________________________________________________________
consensus TGGGCATCATCAAGTTATCATCAATTCCTGTTGCTATCCACTACTGATCCGCTTG
 
. : . : . : . : . : . :
JMSF048P01- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
JMFF021K21- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
JMFF017I23- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
JMSF003J22- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
JMSF028D02- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
JMSF040K22- GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
rJMSF048P01+ GCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
rJMSF040K22+ GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
rJMSF039N24+ CCCAACAGATTGAAATGGCGATTTCATTGA
                      ____________________________________________________________
consensus GGAGGAAAAGCAGCCCCTCACCCTGCAACTCCCAACAGATTGAAATGGCGATTTCATTGA
 
. : . : . : . : . : . :
JMSF048P01- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
JMFF021K21- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
JMFF017I23- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
JMSF003J22- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
JMSF028D02- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
JMSF040K22- CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
rJMSF048P01+ CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
rJMFF021K21+ TCACAGAGGCCCC
rJMSF003J22+ ACGTCTCACAGAGGCCCC
rJMSF040K22+ CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
rJMSF039N24+ CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
                      ____________________________________________________________
consensus CTTCTCTCACCGCATCCTTCGCCTCTCTCTCCTTCTCCTCTCACGTCTCACAGAGGCCCC
 
. : . : . : . : . : . :
JMSF048P01- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
JMFF021K21- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
JMFF017I23- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
JMSF003J22- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
JMSF028D02- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
JMSF040K22- GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMSF048P01+ GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMFF021K21+ GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMSF003J22+ GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMSF040K22+ GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMSF039N24+ GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
rJMSF028D02+ CTCATACGCGCAAAATCCCTA
                      ____________________________________________________________
consensus GTGCGCTGTCGTTTACCCATTCCAATCGCCTCTCTCTGTCTCATACGCGCAAAATCCCTA
 
. : . : . : . : . : . :
JMSF048P01- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
JMFF021K21- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
JMFF017I23- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
JMSF003J22- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
JMSF028D02- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
JMSF040K22- GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMSF048P01+ GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMFF021K21+ GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMSF003J22+ GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMSF040K22+ GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMSF039N24+ GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
rJMFF017I23+ AGGCAGCTCCNTTGACCGAGGATCTGGAANCCG
rJMSF028D02+ GCTTCGTCGTAG-GGCCTCCGCCGTGGAGGCAGCTCCCNTGACCGAGGATCTGGAAACCG
                      ____________________________________________________________
consensus GCTTCGTCGTAGTGGCCTCCGCCGTGGAGGCAGCTCCCTTGACCGAGGATCTGGAAACCG
 
. : . : . : . : . : . :
JMSF048P01- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
JMFF021K21- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
JMFF017I23- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
JMSF003J22- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
JMSF028D02- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
JMSF040K22- CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMSF048P01+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMFF021K21+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMSF003J22+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMSF040K22+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMSF039N24+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMFF017I23+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
rJMSF028D02+ CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
                      ____________________________________________________________
consensus CTGACCTCCAGAAGTATGTCAAGTCCAGGCTTCCTGGTGGCTTCGCCGCCCAAACTATAT
 
. : . : . : . : . : . :
JMSF048P01- TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
JMFF021K21- TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
JMFF017I23- TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGT
JMSF003J22- TC
JMSF028D02- TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
JMSF040K22- TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMSF048P01+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMFF021K21+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMSF003J22+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMSF040K22+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMSF039N24+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
rJMFF017I23+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTNGTCCTCAAGGAAGGTTCCGGCA
rJMSF028D02+ TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
                      ____________________________________________________________
consensus TCGGAACTGGCCGCCGCAAGTCCGCCAGTGCTCGCGTCGTCCTCAAGGAAGGTTCCGGCA
 
. : . : . : . : . : . :
JMSF048P01- AAGTCATCATAAACTATCGCGACGCCNAGGAATATCTTCAAGGAAACCCATTGTGGATTC
JMFF021K21- AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
JMSF028D02- AAGTCATCATAAACTATCGCGACGCCNAGGAATATCTTCAAGGAAACCCATTGTGGATTC
JMSF040K22- AAGTCATCATAAACTATCGCGACGCCNAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMSF048P01+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMFF021K21+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMSF003J22+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMSF040K22+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMSF039N24+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMFF017I23+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
rJMSF028D02+ AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
                      ____________________________________________________________
consensus AAGTCATCATAAACTATCGCGACGCCAAGGAATATCTTCAAGGAAACCCATTGTGGATTC
 
. : . : . : . : . : . :
JMSF048P01- AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
JMFF021K21- AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
JMSF028D02- AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
JMSF040K22- AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMSF048P01+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMFF021K21+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMSF003J22+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMSF040K22+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMSF039N24+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMFF017I23+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
rJMSF028D02+ AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
                      ____________________________________________________________
consensus AGTATGTTAGAACTCCGTTGGTAGTTTTAGGATATGAAAGTAGTTATGATGTTTTTGTCA
 
. : . : . : . : . : . :
JMSF048P01- AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
JMFF021K21- AGGCACAAGGTGGTGGTCTTTCTGGACA
JMSF028D02- AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
JMSF040K22- AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMSF048P01+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMFF021K21+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMSF003J22+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMSF040K22+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMSF039N24+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMFF017I23+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
rJMSF028D02+ AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
                      ____________________________________________________________
consensus AGGCACAAGGTGGTGGTCTTTCTGGACAGGCCCAAGCAATCTCCCTTGGCATTGCTCGTG
 
. : . : . : . : . : . :
JMSF048P01- CTCTACTGAAAGTGAGCGAGAGCCAT
JMSF028D02- CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGA
JMSF040K22- CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAG
rJMSF048P01+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMFF021K21+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMSF003J22+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMSF040K22+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMSF039N24+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMFF017I23+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
rJMSF028D02+ CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
                      ____________________________________________________________
consensus CTCTACTGAAAGTGAGCGAGAGCCATAGAAAACCTTTGAGAGAAGAAGGCCTACTGACCA
 
. : . : . : . : . : . :
rJMSF048P01+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMFF021K21+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMSF003J22+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMSF040K22+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMSF039N24+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMFF017I23+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
rJMSF028D02+ GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
                      ____________________________________________________________
consensus GAGACTCGAGAGTAGTGGAAAGGAAGAAAGTTGGTCTCAAGAAAGCTCGGAAAGCTCCAC
 
. : . : . : . : . : . :
rJMSF048P01+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMFF021K21+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMSF003J22+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMSF040K22+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMSF039N24+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMFF017I23+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
rJMSF028D02+ AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
                      ____________________________________________________________
consensus AATATTCCAAACGTTGAGATATTTTGGATGATCATAGGCGAAGCAGTAGGATTGCTGATC
 
. : . : . : . : . : . :
rJMSF048P01+ ATGTATGGTATATCCAAGAGTT
rJMFF021K21+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
rJMSF003J22+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
rJMSF040K22+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
rJMSF039N24+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATTCC
rJMFF017I23+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
rJMSF028D02+ ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
                      ____________________________________________________________
consensus ATGTATGGTATATCCAAGAGTTTAAGATGAACTAATGAGCTATATTTTGAGATATATT-C
 
. : . : . : . : . : . :
rJMFF021K21+ CTTGTAAATTACTC
rJMSF003J22+ CTTGTAAATTACTCATTATGTTGTA
rJMSF040K22+ CTTGTAAATTACTCATTATTTTGTA
rJMSF039N24+ CTTGTAAATTACTCATTATGTTGTA
rJMFF017I23+ CTTGTAAATTACTCANGAANTTGTAGTGTTTTAAATGAAGAAGAGAACTCAAT
rJMSF028D02+ CTTGTAAATTACTCATTATGTTGTAGTGTTTTAAATGAAGAAGAGAACTCAATTGTCTTG
                      ____________________________________________________________
consensus CTTGTAAATTACTCATTATGTTGTAGTGTTTTAAATGAAGAAGAGAACTCAATTGTCTTG
 
. : . : . : . : . : . :
rJMSF028D02+ TTACCTGAAATTACCATTTTTTTCCTGCTTTTTTCAGTTGGACCAATAACCTTCATCCTT
                      ____________________________________________________________
consensus TTACCTGAAATTACCATTTTTTTCCTGCTTTTTTCAGTTGGACCAATAACCTTCATCCTT