Previous Contig 012592:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013C07Sequence456005377 (6)gb:NTA496227_16914200.015Nicotiana tabacum partial mRNA for putative rac protein (rac3 gene).720012592 (4)pir|T05645|T056457e-31hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab
JMSF019E04Sequence258005377 (6)687012592 (4)pir|T05645|T056457e-44hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab
JMSF028C24Sequence645012592 (4)pir|T05645|T056457e-56hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab705012592 (4)pir|T05645|T056451e-26hypothetical protein F20D10.300 - Arabidopsis thaliana>gb:ATCHRIV89_1547772 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028C24- GAT
                      ____________________________________________________________
consensus GAT
 
. : . : . : . : . : . :
JMSF028C24- GAGGATGAAGGAGGAGTAACCNTATACCAAGTTGCAAAGTTTGGTGAAGATCATAAAGCT
                      ____________________________________________________________
consensus GAGGATGAAGGAGGAGTAACCNTATACCAAGTTGCAAAGTTTGGTGAAGATCATAAAGCT
 
. : . : . : . : . : . :
JMSF028C24- TACTGCGTTAGATTTAATGTTCTTGAGATGAAAGCAACATGCAGCTGTCANATGTTTGAG
                      ____________________________________________________________
consensus TACTGCGTTAGATTTAATGTTCTTGAGATGAAAGCAACATGCAGCTGTCANATGTTTGAG
 
. : . : . : . : . : . :
JMSF028C24- TTCTCAGGTCTTCTTTGCAGGCATGTATTGGCAGTATTCAGAGTGACAAATGTTCTTACT
rJMSF019E04+ TCTTTGCAGGCATGTATTGGCAGTATTCAGAGTGACAAATGTTCTTACT
                      ____________________________________________________________
consensus TTCTCAGGTCTTCTTTGCAGGCATGTATTGGCAGTATTCAGAGTGACAAATGTTCTTACT
 
. : . : . : . : . : . :
JMSF028C24- CTTCCCTCTCATTACATTTTGAAGCGATGGACAAGGAATGCGAAGAGTACTGTTACACTT
rJMSF019E04+ CTTCCCTCTCATTACATTTTGAAGCGATGGACAAGGAATGCGAAGAGTACTGTTACACTT
rJMSF013C07+ AGCGATGGACAAGGAATGCGAAGAGTACTGTTACACNT
                      ____________________________________________________________
consensus CTTCCCTCTCATTACATTTTGAAGCGATGGACAAGGAATGCGAAGAGTACTGTTACACTT
 
. : . : . : . : . : . :
JMSF028C24- GAGGAACGTGTTGCTGATGCATTCAGTGGCTATTTGGAATCACATACTGTTCGATATAAT
rJMSF019E04+ GAGGAACGTGTTGCTGATGCATTCAGTGGCTATTTGGAATCNCATACTGTTCGATATAAT
rJMSF013C07+ GAGGAACGTGTTGCTGATGCATTCAGTGGCTATTNGGAATCACATACTGTTCGATATAAT
rJMSF028C24+ TGCTGATGCATTCAGNGGCTATTGGG-ATCACATACTGTTCGATATAAT
                      ____________________________________________________________
consensus GAGGAACGTGTTGCTGATGCATTCAGTGGCTATTTGGAATCACATACTGTTCGATATAAT
 
. : . : . : . : . : . :
JMSF028C24- ATGTTGCGGCATGAAGCTTTTAAGTTTGTGGAAGATGGGGCAGAATCAGTTTCCTCTTAT
rJMSF019E04+ ATGTTGCGGCNTGAAGCTTTTAAGTTTGTGGAAGATGGGGCNGAATCAGTTTCCTCTTAT
rJMSF013C07+ ATGTTGCGGCATGAAGCTTTTAAGTTTGTGGAAGATGGGGCAGAATCAGTTTCCTCTTAT
rJMSF028C24+ ATGNTGCGGCATGAAGCTTTTAAGTTTGTGGAAGATGGGGCAGAATCAGTTTCCTCTTAT
                      ____________________________________________________________
consensus ATGTTGCGGCATGAAGCTTTTAAGTTTGTGGAAGATGGGGCAGAATCAGTTTCCTCTTAT
 
. : . : . : . : . : . :
JMSF028C24- GTCATAGCAATGGCTGCTTTAGGTGAGGCTTCAAAAAAAGTTTCTCTAGCTGCTAAACAT
rJMSF019E04+ GTCATAGCAATGGCTGCTTTAGGTGAGGCTTCAAAAAAAGTTTCTCTAGCTGCTAAACNT
rJMSF013C07+ GTCATAGCAATGGCTGCTTTAGGTGAGGCTTC-AAAAAAGTTTCTCTAGCTGCTAAACAT
rJMSF028C24+ GTCATAGCAATGGCTGCNTTAGGTGAGGCTTCAAAAAAAGTTTCTCTAGCTGCTAAACAT
                      ____________________________________________________________
consensus GTCATAGCAATGGCTGCTTTAGGTGAGGCTTCAAAAAAAGTTTCTCTAGCTGCTAAACAT
 
. : . : . : . : . : . :
JMSF028C24- GATGGGAAGATCTCCTTGTTGAATGGATGGAACCAAGATGACTCAATCTCTGATGGTATC
rJMSF019E04+ GATGGGAAGATCTCCTTGTTGAATGGATGGAACCNAGATGACTCAATCTCTGATGGTATC
rJMSF013C07+ GATGGGAAGATCTCCTTGTTGAATGGATGGAACCAAGATGACTCAATCTCTGATGGTATC
rJMSF028C24+ GATGGGAAGATCTCCTTGTTGAATGGATGGAACCAAGATGACTCAATCTCTGATGGTATC
                      ____________________________________________________________
consensus GATGGGAAGATCTCCTTGTTGAATGGATGGAACCAAGATGACTCAATCTCTGATGGTATC
 
. : . : . : . : . : . :
JMSF028C24- CAGGAGAATCTGAACATTGAGGATCAGCAAGGAACATTCACAAAGCTACTCTCTGAGGAT
rJMSF019E04+ CNGGAGAATNTGAACNTTGAGGATCAGCAAGGAACNTTCNCAAAGCTACTCTNTGAGGAT
rJMSF013C07+ CAGGAGAATCTGAACATTGAGGATCAGCAAGGAACATTCACAAAGCTACTCTCTGAGGAT
rJMSF028C24+ CAGGAGAATCTGAACATTGAGGATCAGCAAGGAACATTCACAAAGCTACTCTCTGAGGAT
                      ____________________________________________________________
consensus CAGGAGAATCTGAACATTGAGGATCAGCAAGGAACATTCACAAAGCTACTCTCTGAGGAT
 
. : . : . : . : . : . :
JMSF028C24- GATGTGNACAGGGAGATCCATGAACTTACTTGTGAATTANACTGCGCCAATAGAAGATGT
rJMSF019E04+ GATGTGGACNGGAAGATCCNTGAACTTACTTGTGAATTAGACTGCGCCNATAGAAGATGT
rJMSF013C07+ GATGTGGACAGGAAGATCCATGAACTTACTTGTGAATTAGACTGCGCCAATAGAAGATGT
rJMSF028C24+ GATGTGGACAGGGAGATCCATGAACTTACTTGTGAATTAGACTGCGCCAATAGAAGATGT
                      ____________________________________________________________
consensus GATGTGGACAGGGAGATCCATGAACTTACTTGTGAATTAGACTGCGCCAATAGAAGATGT
 
. : . : . : . : . : . :
JMSF028C24- GAAGNTTACCGTGTAAACCTCCNTTCAGTTTTGAAGGATATA
rJMSF019E04+ GAAGTTTACCGTGTAAACCTCCTTTCAGTTTTGAAGGATATAGAAGNCCNTAAACNGCAA
rJMSF013C07+ GAAGTTTACCGTGTAAACCTCCTTTCAGTTTTGAAGGATATAGAAGACCATAAACAGCAA
rJMSF028C24+ GAAGTTTACCGTGTAAACCTCCTTTCAGTTTTGAAGGATATAGAAGACCATAAACAGCAA
                      ____________________________________________________________
consensus GAAGTTTACCGTGTAAACCTCCTTTCAGTTTTGAAGGATATAGAAGACCATAAACAGCAA
 
. : . : . : . : . : . :
rJMSF019E04+ TTGTCNATAAAGGTTCAAAATATAAAGATCNGCNTGAAGGATGATCTCTGAAGATTTATA
rJMSF013C07+ TTGTCAATAAAGGTTCAAAATATAAAGATCAGCATGAAGGATGATCTCTGAAGATTTATA
rJMSF028C24+ TTGTCAATAAAGGTTCAAAATATAAAGATCAGCNTGAAGGATGATCTCTGAAGATTTATA
                      ____________________________________________________________
consensus TTGTCAATAAAGGTTCAAAATATAAAGATCAGCATGAAGGATGATCTCTGAAGATTTATA
 
. : . : . : . : . : . :
rJMSF019E04+ TCTTTTTGTATAGATTTTTTTTTTATTTTTATTTTTTTTTATTTTATTTTATTATTATTT
rJMSF013C07+ TCTTTTTGTATAGA-TTTTTTTTTATTTTTATTTTTTTTTATTTTATTTTATTATTA-TT
rJMSF028C24+ TCTTTTTGTATAGA-TTTTTTTTTATTTTTATTTTTTTTTATTTTATTTTATTATTATTT
                      ____________________________________________________________
consensus TCTTTTTGTATAGA-TTTTTTTTTATTTTTATTTTTTTTTATTTTATTTTATTATTATTT
 
. : . : . : . : . : . :
rJMSF019E04+ TTTTTTGAGTAGGCAGGCATTTGTAGGTAAACATATT
rJMSF013C07+ TTTTTTGAGTAGGCAGGCATTTGTAGGTAAACATATTTGTAGCTTCAACTTTTACATAGA
rJMSF028C24+ TTTTTTGAGTAGGCAGGCATTTGTAGGTAAACATATTTGTAGCTTCAACTTTTACATAGA
                      ____________________________________________________________
consensus TTTTTTGAGTAGGCAGGCATTTGTAGGTAAACATATTTGTAGCTTCAACTTTTACATAGA
 
. : . : . : . : . : . :
rJMSF013C07+ TATCTTGATGACTAGTTAGTAATTGAATCTCTTTTGTGAGGTGTATAAAAATGGTAATGT
rJMSF028C24+ TATCTTGATGACTAGTTAGTAATTGAATCTCTTTTGTGAG--GTATAAAAATGGTAATGT
                      ____________________________________________________________
consensus TATCTTGATGACTAGTTAGTAATTGAATCTCTTTTGTGAGGTGTATAAAAATGGTAATGT
 
. : . : . : . : . : . :
rJMSF013C07+ GGCCCCANGCCAAGTNTTTT
rJMSF028C24+ GGCACCATGCCAAGTTTTTTCTGTGGCTGGCTGGTCTCTGTAGTTGGGTGTCAAAGGAAG
                      ____________________________________________________________
consensus GGCCCCATGCCAAGTTTTTTCTGTGGCTGGCTGGTCTCTGTAGTTGGGTGTCAAAGGAAG