Previous Contig 012591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010D10Sequence539012591 (6)pir|C96609|C966097e-17hypothetical protein T8L23.1 [imported] - Arabidopsis thaliana>gb:AE005173_89354713012591 (6)gb:AP001278_18209071e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08
JMFF047B22Sequence611012591 (6)pir|C96609|C966094e-27hypothetical protein T8L23.1 [imported] - Arabidopsis thaliana>gb:AE005173_89354546012591 (6)gb:AP001278_18209076e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08
JMSF012D17Sequence463012591 (6)gb:AP005918_18601200.033Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P041749022481gb:AP001278_18209071e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08
JMSF028C20Sequence697006739 (7)gb:AY101603_15776577e-65Petunia x hybrida nam-like protein 1 (Nh1) mRNA, Nh1-R27 allele, complete cds.763012591 (6)gb:AP001278_18209074e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0434D08

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012D17- GCACT
JMFF010D10- GCACT
JMFF047B22- GGGTGTGCACT
                      ____________________________________________________________
consensus GGGTGTGCACT
 
. : . : . : . : . : . :
JMSF012D17- TCTACGCTCCGCCTTCTGCCCCTCCACACCATACCTTCACCTTCTCGACTTCTCGTTGAC
JMFF010D10- TCTACGCTCCGCCTTCTGCCCCTCCACACCATACCTTCACCTTCTCGACTTCTCGTTGAC
JMFF047B22- TCTACGCTCCGCCTTCTGCCCCTCCACACCATACCTTCACCTTCTCGACTTCTCGTTGAC
                      ____________________________________________________________
consensus TCTACGCTCCGCCTTCTGCCCCTCCACACCATACCTTCACCTTCTCGACTTCTCGTTGAC
 
. : . : . : . : . : . :
JMSF012D17- TCCTTTACTCGTTCAGCAAGCCGGCAACGCCAACACTCCCGCAGCCTTGCGCCTCAGCAG
JMFF010D10- TCCTTTACTCGTTCAGCAAGCCGGCAACGCCAACACTCCCGCAGCCTTGCGCCTCAGCAG
JMFF047B22- TCCTTTACTCGTTCAGCAAGCCGGCAACGCCAACACTCCCGCAGCCTTGCGCCTCAGCAG
rJMFF010D10+ TCAGCAG
                      ____________________________________________________________
consensus TCCTTTACTCGTTCAGCAAGCCGGCAACGCCAACACTCCCGCAGCCTTGCGCCTCAGCAG
 
. : . : . : . : . : . :
JMSF012D17- CGACTGCTGCCCGTTG-CCCCGTTGTCAGCACTCAGCAGACAGCGATTCGTCGTCAGTGG
JMFF010D10- CGACTGCTGCCCGTTG-CCCCGTTGTCAGCACTCAGCAGACAGCGATTCGTCGTCAGTGG
JMFF047B22- CGACTGCTGCCCGTTG-CCCCGTTGTCAGCACTCAGCAGACAGCGATTCGTCGTCAGTGG
rJMFF010D10+ CGACTGCTGCCCGTTGCCCCCGTTGTCAGCACTCAGCAGACAGCGATTCGTCGTCAGTGG
                      ____________________________________________________________
consensus CGACTGCTGCCCGTTG-CCCCGTTGTCAGCACTCAGCAGACAGCGATTCGTCGTCAGTGG
 
. : . : . : . : . : . :
JMSF012D17- CCGGTGCCCGGTGCCCGTCGTCTACTCGTCCGGAAAGCGGCA----CTTTCCCTAGCCCT
JMFF010D10- CCGGTGCCCGGTGCCCGTCGTCTACTCGTCCGGAAAGCGGCAGTAGCTTTCCCTAGCCCT
JMFF047B22- CCGGTGCCCGGTGCCCGTCGTCTACTCGTCCGGAAAGCGGCAGTAGCTTTCCCTAGCCCT
rJMFF010D10+ CCGGTGCCCGGTGCCCGTCGTCTACTCGTCCGGAAAGCGGCAGTAGCTTTCCCTAGCCCT
                      ____________________________________________________________
consensus CCGGTGCCCGGTGCCCGTCGTCTACTCGTCCGGAAAGCGGCAGTAGCTTTCCCTAGCCCT
 
. : . : . : . : . : . :
JMSF012D17- TGATCAAAACGCGGTCGTCTGGTGCACAGCCGTTACCCTCCTTCGAAACGGTGTCGTTCC
JMFF010D10- TGATCAAAACGCGGTCGTCTGGTGCACAGCCGTTACCCTCCTTCGAAACGGTGTCGTTCC
JMFF047B22- TGATCAAAACGCGGTCGTCTGGTGCACAGCCGTTACCCTCCTTCGAAACGGTGTCGTTCC
rJMFF010D10+ TGATCAAAACGCGGTCGTCTGGTGCACAGCCGTTACCCTCCTTCGAAACGGTGTCGTTCC
                      ____________________________________________________________
consensus TGATCAAAACGCGGTCGTCTGGTGCACAGCCGTTACCCTCCTTCGAAACGGTGTCGTTCC
 
. : . : . : . : . : . :
JMSF012D17- ACTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGG
JMFF010D10- ACTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGGA
JMFF047B22- ACTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGGA
rJMFF010D10+ ACTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGGA
rJMFF047B22+ CTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGGA
                      ____________________________________________________________
consensus ACTTAATGCCCAACGGCTCTCACCTTCCCCCTTCATGCGACGTCGTTTACCTGCTGAGGA
 
. : . : . : . : . : . :
JMFF010D10- ATTAAGGTGCACCATGGCATTGAGGCAATTGTGTGGATTTTCTGATGGGGAGGTGATGAG
JMFF047B22- ATTAAGGTGCACCATGGCATTGAGGCAATTGTGTGGATTTTCTGATGGGGAGGTGATGAG
rJMFF010D10+ ATTAAGGTGCACCATGGCATTGAGGCAATTGTGTGGATTTTCTGATGGGGAGGTGATGAG
rJMFF047B22+ ATTAAGGTGCACCATGGCATTGAGGCAATTGTGTGGATTTTCTGATGGGGAGGTGATGAG
                      ____________________________________________________________
consensus ATTAAGGTGCACCATGGCATTGAGGCAATTGTGTGGATTTTCTGATGGGGAGGTGATGAG
 
. : . : . : . : . : . :
JMFF010D10- ATCAGATTGTAAGACTTGTTCCAGATTGACGAGACAGACTGCTGCAATATTCTCAGTTGG
JMFF047B22- ATCAGATTGTAAGACTTGTTCCAGATTGACGAGACAGACTGCTGCAATATTCTCAGTTGG
rJMFF010D10+ ATCAGATTGTAAGACTTGTTCCAGATTGACGAGACAGACTGCTGCAATATTCTCAGTTGG
rJMFF047B22+ ATCAGATTGTAAGACTTGTTCCAGATTGACGAGACAGACTGCTGCAATATTCTCAGTTGG
                      ____________________________________________________________
consensus ATCAGATTGTAAGACTTGTTCCAGATTGACGAGACAGACTGCTGCAATATTCTCAGTTGG
 
. : . : . : . : . : . :
JMFF010D10- AGGAGCATTANGCTTTTGGGTGCTGTGCCGCTTGCACTACGGCCCTAGAA
JMFF047B22- AGGAGCATTAGGCTTTTGGGTGCTGTGCCGCTTGCACTACGGCCCTAGAATCACAAATCC
rJMFF010D10+ AGGAGCATTAGGCTTTTGGGTGCTGTGCCGCTTGCACTACGGCCCTAGAATCACAAATCC
rJMFF047B22+ AGGAGCATTAGGCTTTTGGGTGCTGTGCCGCTTGCACTACGGCCCTAGAATCACAAATCC
rJMSF028C20+ GGCCCTAGAATCACAAATCC
                      ____________________________________________________________
consensus AGGAGCATTAGGCTTTTGGGTGCTGTGCCGCTTGCACTACGGCCCTAGAATCACAAATCC
 
. : . : . : . : . : . :
JMFF047B22- TCGAAGTTTTAGGTGGGGAGCTTGTGGAGCAGTCTCTACAAGCTCTACCACCGCATTGCT
rJMFF010D10+ TCGAAGTTTTAGGTGGGGAGCTTGTGGAGCAGTCTCTACAAGCTCTACCACCGCATTGCT
rJMFF047B22+ TCGAAGTTTTAGGTGGGGAGCTTGTGGAGCAGTCTCTACAAGCTCTACCACCGCATTGCT
rJMSF028C20+ TCGAAGTTTTAGGTGGGGGGCTTGTGGAGCAGTCTCTACGAGCTCTACCACCGCATTGCT
                      ____________________________________________________________
consensus TCGAAGTTTTAGGTGGGGAGCTTGTGGAGCAGTCTCTACAAGCTCTACCACCGCATTGCT
 
. : . : . : . : . : . :
JMFF047B22- G
rJMFF010D10+ GGTTCGCCTGTTTAGTCCAGAATGTGAACCTCAAAATATAGCTGCTTATGACAAAAAAGG
rJMFF047B22+ GGTTCGCCTGTTTAGTCCAGAATGTGAACCTCAAAATATAGCTGCTTATGACAAAAAAGG
rJMSF028C20+ GGTTCGCCTGTTTAGTCCAGAATGTGAGCCTCAAAATATCGCTGCTTATGACAAGAAAGG
                      ____________________________________________________________
consensus GGTTCGCCTGTTTAGTCCAGAATGTGAACCTCAAAATATAGCTGCTTATGACAAAAAAGG
 
. : . : . : . : . : . :
rJMFF010D10+ ATAGTGCTGCCTATTCACAAGCTTTGACTATCCTATGATGGCAATTGGGGTCTTGCACTT
rJMFF047B22+ ATAGTGCTGCCTATTCACAAGCTTTGACTATCCTATGATGGCAATTGGGGTCTTGCACTT
rJMSF028C20+ ATAGTGTTGCCTATTCACAAGCTTTGACTACCCTATGATGGCAGTTGGGGTCTTACGCTT
                      ____________________________________________________________
consensus ATAGTGCTGCCTATTCACAAGCTTTGACTATCCTATGATGGCAATTGGGGTCTTGCACTT
 
. : . : . : . : . : . :
rJMFF010D10+ GGAGTTATGGAG
rJMFF047B22+ GGAGTTATGGAG
rJMSF028C20+ GGAGTTATGGAGGTTGCCCGAGTTGAATAAATGAATTGATTATTGTCTTTACTGTCACTT
                      ____________________________________________________________
consensus GGAGTTATGGAGGTTGCCCGAGTTGAATAAATGAATTGATTATTGTCTTTACTGTCACTT
 
. : . : . : . : . : . :
rJMSF028C20+ CTGTGCTTGTTCTAGGAGTTTGTATTGCTGCCTTTTGAATAATATATGACATAGATAATG
                      ____________________________________________________________
consensus CTGTGCTTGTTCTAGGAGTTTGTATTGCTGCCTTTTGAATAATATATGACATAGATAATG
 
. : . : . : . : . : . :
rJMSF028C20+ ACTTTGTTACTGACTGCTGATAATGTATTTGTCCATGCACTACTTCAATGTTATTCTATT
                      ____________________________________________________________
consensus ACTTTGTTACTGACTGCTGATAATGTATTTGTCCATGCACTACTTCAATGTTATTCTATT
 
. : . : . : . : . : . :
rJMSF028C20+ TCATTCAATTTCCTTTTAAATCCATAAGATTGTGTGTTTCCAAAAATGCAGACTCTATAA
                      ____________________________________________________________
consensus TCATTCAATTTCCTTTTAAATCCATAAGATTGTGTGTTTCCAAAAATGCAGACTCTATAA
 
. : . : . : . : . : . :
rJMSF028C20+ TACAACTATACAAGATGCCATTATGGCTCTAAAGATTACATTGGGCTTCCTAATTTCTGT
                      ____________________________________________________________
consensus TACAACTATACAAGATGCCATTATGGCTCTAAAGATTACATTGGGCTTCCTAATTTCTGT
 
. : . : . : . : . : . :
rJMSF028C20+ TGTTAATGCTCTCTTTAATTTCTTGGGCAGGGCATTGGACAAATCAACATGCTTTGTTTT
                      ____________________________________________________________
consensus TGTTAATGCTCTCTTTAATTTCTTGGGCAGGGCATTGGACAAATCAACATGCTTTGTTTT
 
. : . : . : . : . : . :
rJMSF028C20+ TCCTACTTCACTTGGAGCAAAGGTTCTTGTCATTCTTTACACAAATATATCGGCTTTTAA
                      ____________________________________________________________
consensus TCCTACTTCACTTGGAGCAAAGGTTCTTGTCATTCTTTACACAAATATATCGGCTTTTAA
 
. : . : . : . : . : . :
rJMSF028C20+ TCTACATTCCCCTTTTCTTTATGATATAAGATACCTTGTATATACATTGCCTCAAGATTA
                      ____________________________________________________________
consensus TCTACATTCCCCTTTTCTTTATGATATAAGATACCTTGTATATACATTGCCTCAAGATTA