Previous Contig 012575:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032E12Sequence585012575 (3)pir|T02996|T029965e-66N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998102021379
JMFF040D09Sequence498012575 (3)pir|T02996|T029963e-66N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998269021584
JMSF027O20Sequence659006498 (4)pir|T02996|T029967e-72N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998707012575 (3)pir|T02996|T029962e-91N-ethylmaleimide sensitive fusion protein NSF - common tobacco>gb:D86506_1674998

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032E12+ AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
JMFF032E12+ TAAGCCCAGAAAAATGGTGGCACTCAAAATGGTTGTGGCTCAAAGAATTACAAATATGGC
                      ____________________________________________________________
consensus TAAGCCCAGAAAAATGGTGGCACTCAAAATGGTTGTGGCTCAAAGAATTACAAATATGGC
 
. : . : . : . : . : . :
JMFF040D09+ ATCGAACAATATCCTGG
JMFF032E12+ CGTGAAATTGGTTGAACNTAAACTTGGGCAGACATAAACTAGTATCGAACAATATCCTGG
rJMSF027O20- ATCGAACAATATCCTGG
                      ____________________________________________________________
consensus CGTGAAATTGGTTGAACNTAAACTTGGGCAGACATAAACTAGTATCGAACAATATCCTGG
 
. : . : . : . : . : . :
JMFF040D09+ AAGCAATCATAGAAATGTGAAATATTGATCTTTTCTTTTCCGGAGAAAATGGCTTCTGCT
JMFF032E12+ AAGCAATCATAGAAATGTGAAATATTGATCTTTTCTTTTCCGGAGAAAATGGCTTCTGCT
rJMSF027O20- AAGCAATCATAGAAATGTGAAATATTGATCTTTTCTTTTCCGGAGAAAATGGCTTCTGCT
                      ____________________________________________________________
consensus AAGCAATCATAGAAATGTGAAATATTGATCTTTTCTTTTCCGGAGAAAATGGCTTCTGCT
 
. : . : . : . : . : . :
JMFF040D09+ CTCCCACCGTGCTGGCCCTGAGCAGCCATTTCAATGACCATGTAGAGTTTCTTGATTGGC
JMFF032E12+ CTCCCACCGTGCTGGCCCTGAGCAGCCATTTCAATGACCATGTAGAGTTTCTTGATTGGC
rJMSF027O20- CTCCCACCGTGCTGGCCCTGAGCAGCCATTTCAATGACCATGTAGAGTTTCTTGATTGGC
                      ____________________________________________________________
consensus CTCCCACCGTGCTGGCCCTGAGCAGCCATTTCAATGACCATGTAGAGTTTCTTGATTGGC
 
. : . : . : . : . : . :
JMFF040D09+ GTATCATTTAATGCATCAGCAACAGAATCAACATCCTCCCTTGAGAACACATTAAGTTGC
JMFF032E12+ GTATCATTTAATGCATCAGCAACAGAATCAACATCCTCCCTTGAGAACACATTAAGTTGC
rJMSF027O20- GTATCATTTAATGCATCAGCAACAGAATCAACATCCTCCCTTGAGAACACATTAAGTTGC
                      ____________________________________________________________
consensus GTATCATTTAATGCATCAGCAACAGAATCAACATCCTCCCTTGAGAACACATTAAGTTGC
 
. : . : . : . : . : . :
JMFF040D09+ TCTAACACCTTCTTAGCATCCTCTGTCTTTAATGTTGGGACATGATGTGTGACTGAGAAC
JMFF032E12+ TCTAACACCTTCTTAGCATCCTCTGTCTTTAATGTTGGGACATGATGTGTGACTGAGAAC
rJMSF027O20- TCTAACACCTTCTTAGCATCCTCTGTCTTTAATGTTGGGACATGATGTGTGACTGAGAAC
                      ____________________________________________________________
consensus TCTAACACCTTCTTAGCATCCTCTGTCTTTAATGTTGGGACATGATGTGTGACTGAGAAC
 
. : . : . : . : . : . :
JMFF040D09+ GCATCACGAACACCAACTGACTCCAAGAAACCAACCTCACTGGTAGTTCCAATCACAAGA
JMFF032E12+ GCATCACGAACACCAACTGACTCCAAGAAACCAACCTCACTGGTAGTTCCAATCACAAGA
rJMSF027O20- GCATCACGAACACCAACTGACTCCAAGAAACCAACCTCACTGGTAGTTCCAATCACAAGA
                      ____________________________________________________________
consensus GCATCACGAACACCAACTGACTCCAAGAAACCAACCTCACTGGTAGTTCCAATCACAAGA
 
. : . : . : . : . : . :
JMFF040D09+ ATTTTTTTACCCTTTGGAGGAAGCCGCTTGAGGAGCACCAACAATGTCTGGGATATCAAA
JMFF032E12+ ATTTTTTTACCCTTTGGAGGAAGCCGCTTGAGGAGCACCAACAATGTCTGGGATATCAAA
rJMSF027O20- ATTTTTTTACCCTTTGGAGGAAGCCGCTTGAGGAGCACCAACAATGTCTGGGATATCAAA
                      ____________________________________________________________
consensus ATTTTTTTACCCTTTGGAGGAAGCCGCTTGAGGAGCACCAACAATGTCTGGGATATCAAA
 
. : . : . : . : . : . :
JMFF040D09+ TTTGAAAATCGAGGGCCAATGGCAACATACTCAAGTAGCCTTTCAATGTCATCAAGGATG
JMFF032E12+ TTTGAAAATCGAGGGCCAATGGCAACATACTCAAGTAGCCTTTCAATGTCATCAAGGATG
rJMSF027O20- TTTGAAAATCGAGGGCCAATGGCAACATACTCAAGTAGCCTTTCAATGTCATCAAGGATG
                      ____________________________________________________________
consensus TTTGAAAATCGAGGGCCAATGGCAACATACTCAAGTAGCCTTTCAATGTCATCAAGGATG
 
. : . : . : . : . : . :
JMFF040D09+ ATTATGCTTAGTGGCGATCTGTAAGCATCCTCAAAAACCTTGA
JMFF032E12+ ATTATGCTTAGTGGCGATCTGTAAGCATCCTCAAAAACCTTGA
rJMSF027O20- ATTATGCTTAGTGGCGATCTGTAAGCATCCTCAAAAACCTTGACAATTTGAGCACATTTA
                      ____________________________________________________________
consensus ATTATGCTTAGTGGCGATCTGTAAGCATCCTCAAAAACCTTGACAATTTGAGCACATTTA
 
. : . : . : . : . : . :
rJMSF027O20- CTACCCTCACTTAATCCAATCATTGTCTCTGCAGAGATTATCTTTACATATGGAAAATCA
                      ____________________________________________________________
consensus CTACCCTCACTTAATCCAATCATTGTCTCTGCAGAGATTATCTTTACATATGGAAAATCA
 
. : . : . : . : . : . :
rJMSF027O20- CTTTCAATACCGACTGTTGCTGCCATTGCAGTCTTACCACTGCCACTGGGGCCTTCTAGA
                      ____________________________________________________________
consensus CTTTCAATACCGACTGTTGCTGCCATTGCAGTCTTACCACTGCCACTGGGGCCTTCTAGA