Previous Contig 012574:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN009N01Sequence627012574 (2)gb:AP004691_18434791e-94Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMSF027O18Sequence667006292 (3)gb:AY059774_15646244e-43Arabidopsis thaliana unknown protein (At2g35155) mRNA, complete cds.771012574 (2)gb:AY099637_15766625e-47Arabidopsis thaliana putative protein (At5g45030) mRNA, complete cds.>gb:BT00216

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN009N01- GCAAGCCAGGAGACCTATGGGACATTGGGTGCTATTGTAAGAAGCCAAACAGG
                      ____________________________________________________________
consensus GCAAGCCAGGAGACCTATGGGACATTGGGTGCTATTGTAAGAAGCCAAACAGG
 
. : . : . : . : . : . :
JMFN009N01- AAATCAACAAGTTGGTTTCCTCACAAACCGGCATGTTGCAGTTGATTTAGATTACCCAAA
                      ____________________________________________________________
consensus AAATCAACAAGTTGGTTTCCTCACAAACCGGCATGTTGCAGTTGATTTAGATTACCCAAA
 
. : . : . : . : . : . :
JMFN009N01- TCAAAAGATGTTTCACCCTTTGCCACCAACTCTTGGACCTGGCGTATATCTTGGTTCTGT
                      ____________________________________________________________
consensus TCAAAAGATGTTTCACCCTTTGCCACCAACTCTTGGACCTGGCGTATATCTTGGTTCTGT
 
. : . : . : . : . : . :
JMFN009N01- TGAGAGGGCTACATCTTTCATTAGAGATGACCTTTGGTATGGCATTTTTGCTGGCTTAAA
                      ____________________________________________________________
consensus TGAGAGGGCTACATCTTTCATTAGAGATGACCTTTGGTATGGCATTTTTGCTGGCTTAAA
 
. : . : . : . : . : . :
JMFN009N01- TCCAGAGACATTTGTAAGAGCAGACGGTGCATTCATTCCTTTCACAGATGATTTTGACAT
                      ____________________________________________________________
consensus TCCAGAGACATTTGTAAGAGCAGACGGTGCATTCATTCCTTTCACAGATGATTTTGACAT
 
. : . : . : . : . : . :
JMFN009N01- GACTGCAGTGACGACATCTGTGAAAGGCATTGGAGAGATAGGAGGTGTCAAGATCATAGA
                      ____________________________________________________________
consensus GACTGCAGTGACGACATCTGTGAAAGGCATTGGAGAGATAGGAGGTGTCAAGATCATAGA
 
. : . : . : . : . : . :
JMFN009N01- CTTGCAAGCCTCCATCAATAGTCTTATCGGGAAGCAGGTGATGAAGGTCGGAAGGAGTTC
                      ____________________________________________________________
consensus CTTGCAAGCCTCCATCAATAGTCTTATCGGGAAGCAGGTGATGAAGGTCGGAAGGAGTTC
 
. : . : . : . : . : . :
JMFN009N01- TGGTTTTACCACTGGGACTGTGTTGGCATATGCCCTTGAATATAACGATGAAAAGGGGAT
                      ____________________________________________________________
consensus TGGTTTTACCACTGGGACTGTGTTGGCATATGCCCTTGAATATAACGATGAAAAGGGGAT
 
. : . : . : . : . : . :
JMFN009N01- ATGCTTCTTAACTGACTTTCTGGTGGTCGGAGAGAACCAACAGACTTTTGACCTTGAAGG
rJMSF027O18+ TAACTGACTTTCTGGTGGTCGGAGAGAACCAACAGACTTTTGACC-TGAAGG
                      ____________________________________________________________
consensus ATGCTTCTTAACTGACTTTCTGGTGGTCGGAGAGAACCAACAGACTTTTGACCTTGAAGG
 
. : . : . : . : . : . :
JMFN009N01- GGACAGTGGTAGCCTAATAATCTTAAAGGGTGAGAATGGGGAGAAAGCACGACCAGTCGG
rJMSF027O18+ GGACAGTGGTAGCCTAATAATCTTAAAGGGTGAGAATGGGGAGAAAGCACGACCAGTCGG
                      ____________________________________________________________
consensus GGACAGTGGTAGCCTAATAATCTTAAAGGGTGAGAATGGGGAGAAAGCACGACCAGTCGG
 
. : . : . : . : . : . :
JMFN009N01- GATCATATGGGGTGGAACTGCAAATAGGGGTAGG
rJMSF027O18+ GATCATATGGGGTGGAACTGCAAATAGGGGTAGGCTTAAATTAAAAGTTGGCCAACCGCC
                      ____________________________________________________________
consensus GATCATATGGGGTGGAACTGCAAATAGGGGTAGGCTTAAATTAAAAGTTGGCCAACCGCC
 
. : . : . : . : . : . :
rJMSF027O18+ AGAGAACTGGACTAGTGGGGTTGACCTGGGACGTTTGCTCAAATTCCTTGAACTTGATCT
                      ____________________________________________________________
consensus AGAGAACTGGACTAGTGGGGTTGACCTGGGACGTTTGCTCAAATTCCTTGAACTTGATCT
 
. : . : . : . : . : . :
rJMSF027O18+ CATCACAACCGAGGAAGCTTTGAAAGTTGCAGTACAGGAACAACGAGTTGCTTCAGCAAC
                      ____________________________________________________________
consensus CATCACAACCGAGGAAGCTTTGAAAGTTGCAGTACAGGAACAACGAGTTGCTTCAGCAAC
 
. : . : . : . : . : . :
rJMSF027O18+ AATGGTGGGCTCCACAGTGGGCGATTCTTCGCCTCCCGATGTGATGCTCCTAAAGGACAA
                      ____________________________________________________________
consensus AATGGTGGGCTCCACAGTGGGCGATTCTTCGCCTCCCGATGTGATGCTCCTAAAGGACAA
 
. : . : . : . : . : . :
rJMSF027O18+ AATGGAGCCCTTGGGACTTCATATCCAACCGATTCCAATCGAAGATCCTGCTGGTAGTGG
                      ____________________________________________________________
consensus AATGGAGCCCTTGGGACTTCATATCCAACCGATTCCAATCGAAGATCCTGCTGGTAGTGG
 
. : . : . : . : . : . :
rJMSF027O18+ CCCCGATATAAACTCATCTCCAGTGGAAGCTGCATTTAACATCGAAGATGGAGGGGTGAA
                      ____________________________________________________________
consensus CCCCGATATAAACTCATCTCCAGTGGAAGCTGCATTTAACATCGAAGATGGAGGGGTGAA
 
. : . : . : . : . : . :
rJMSF027O18+ CTTGGGTCCCAGTATCGAACACCAATTCATTCCAAGCTTCAATGGGCGATCACCGCTCCA
                      ____________________________________________________________
consensus CTTGGGTCCCAGTATCGAACACCAATTCATTCCAAGCTTCAATGGGCGATCACCGCTCCA
 
. : . : . : . : . : . :
rJMSF027O18+ TTCTGTCGAAGATCAACATGACAGGCCAGTGGTTTATCAGAACCTCTCAGCTCTAAGGAG
                      ____________________________________________________________
consensus TTCTGTCGAAGATCAACATGACAGGCCAGTGGTTTATCAGAACCTCTCAGCTCTAAGGAG
 
. : . : . : . : . : . :
rJMSF027O18+ TGGCTCTGATCATGAAGAGATTGGCTTTTCTCTGCAGCTGGGAGGCCATGCATCCAAGAG
                      ____________________________________________________________
consensus TGGCTCTGATCATGAAGAGATTGGCTTTTCTCTGCAGCTGGGAGGCCATGCATCCAAGAG
 
. : . : . : . : . : . :
rJMSF027O18+ GAGACGTTCTGAACCTCCTTCTACCCCCAGTAAAGAAGAACAAAAATGAAATTGCCATTT
                      ____________________________________________________________
consensus GAGACGTTCTGAACCTCCTTCTACCCCCAGTAAAGAAGAACAAAAATGAAATTGCCATTT
 
. : . : . : . : . : . :
rJMSF027O18+ CATAATTATTTGTTTCAACTTATGTTGTTTGCTTGGGACTCAAGTAGGAGTGCAAGACTC
                      ____________________________________________________________
consensus CATAATTATTTGTTTCAACTTATGTTGTTTGCTTGGGACTCAAGTAGGAGTGCAAGACTC