Previous Contig 012571:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022F08Sequence616003906 (3)pir|H84824|H848249e-13En/Spm-like transposon protein [imported] - Arabidopsis thaliana>gb:AF002109_176654012571 (2)gb:AP002483_18221993e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0019D06
JMSF027N19Sequence664019491pir|H84824|H848241e-30En/Spm-like transposon protein [imported] - Arabidopsis thaliana>gb:AF002109_176760012571 (2)gb:AP002483_18221993e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0019D06

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022F08+ CCAGNTATG
rJMSF027N19+ AATACATAGCAGTGGAAGCGCTGNTCCCATTCCAGCTATG
                      ____________________________________________________________
consensus AATACATAGCAGTGGAAGCGCTGNTCCCATTCCAGCTATG
 
. : . : . : . : . : . :
rJMSF022F08+ AGCCGGTTACATGCTAAAGNTAATGACAATGTGAGCCCTGTTGTGATTGGAACTAAGATG
rJMSF027N19+ AGCCGGTTACATGCTAAAGCTAATGACAATGTGAGCCCTGTTGTGATTGGAACTAAGATG
                      ____________________________________________________________
consensus AGCCGGTTACATGCTAAAGCTAATGACAATGTGAGCCCTGTTGTGATTGGAACTAAGATG
 
. : . : . : . : . : . :
rJMSF022F08+ GTTGAAAGAGTGATAAATATGCGGAAATTGGCTCCGCCAAAACAAGAGAATAAACATTCC
rJMSF027N19+ GTTGAAAGAGTGATAAATATGCGGAAATTGGCTCCGCCAAAACAAGAGAATAAACATTCC
                      ____________________________________________________________
consensus GTTGAAAGAGTGATAAATATGCGGAAATTGGCTCCGCCAAAACAAGAGAATAAACATTCC
 
. : . : . : . : . : . :
rJMSF022F08+ CCGAATAGTAATTGGTCTGCCAAGTCCTCATCACNTGNCAGCTCGGGCTNTGGAAGAAAT
rJMSF027N19+ CCGAATAGTAATTTGTCTGCCAAGTCCTCATCACCTGACAGCTCGGGCTTTGGAAGAAAT
                      ____________________________________________________________
consensus CCGAATAGTAATTTGTCTGCCAAGTCCTCATCACCTGACAGCTCGGGCTTTGGAAGAAAT
 
. : . : . : . : . : . :
rJMSF022F08+ CTCTNTNAAAAGTCNTNGGATATGGCCNTTAGGCATATGGATATAAGGCGAACAATTCCA
rJMSF027N19+ CTCTCTAAAAAGTCTTTGGATATGGCCATTAGGCATATGGATATAAGGCGAACAATTCCA
                      ____________________________________________________________
consensus CTCTCTAAAAAGTCTTTGGATATGGCCATTAGGCATATGGATATAAGGCGAACAATTCCA
 
. : . : . : . : . : . :
rJMSF022F08+ GGTAATCTNCGACCATTGATGGCTAATATTCCAGCATCATCTATGTACAGTGTGAGAACA
rJMSF027N19+ GGTAATCTACGACCATTGATGGCTAATATTCCAGCATCATCTATGTACAGTGTGAGAACA
                      ____________________________________________________________
consensus GGTAATCTACGACCATTGATGGCTAATATTCCAGCATCATCTATGTACAGTGTGAGAACA
 
. : . : . : . : . : . :
rJMSF022F08+ GGACCTAATAGAAGCAGGGCAGTGAGCGTTTCTGATTCACCACACGCAACAAGCAGTAAT
rJMSF027N19+ GGACCTAATAGAAGCAGGGCAGTGAGCGTTTCTGATTCACCACACGCAACAAGCAGTAAT
                      ____________________________________________________________
consensus GGACCTAATAGAAGCAGGGCAGTGAGCGTTTCTGATTCACCACACGCAACAAGCAGTAAT
 
. : . : . : . : . : . :
rJMSF022F08+ GCTAGTTCCGAAGTCAGCGTTAATAACAATGC
rJMSF027N19+ GCTAGTTCCGAAGTCAGCGTTAATAACAATGCCCTTTGCACCGATGGAAATGAAGTTGAT
                      ____________________________________________________________
consensus GCTAGTTCCGAAGTCAGCGTTAATAACAATGCCCTTTGCACCGATGGAAATGAAGTTGAT
 
. : . : . : . : . : . :
rJMSF027N19+ GATGATATTTGCAGCTATAGAATTGCTCACTCCCCTGCCACGATGCGTGGTAGGTGATGC
                      ____________________________________________________________
consensus GATGATATTTGCAGCTATAGAATTGCTCACTCCCCTGCCACGATGCGTGGTAGGTGATGC
 
. : . : . : . : . : . :
rJMSF027N19+ TCGGCTTGTCTTGTTGAAACAGTCGAGCGTTCAAGCATCCTTGTCTCCACGAGAACCGAG
                      ____________________________________________________________
consensus TCGGCTTGTCTTGTTGAAACAGTCGAGCGTTCAAGCATCCTTGTCTCCACGAGAACCGAG
 
. : . : . : . : . : . :
rJMSF027N19+ TATGGATATGGGTATGGCTATGTAAAGGTGCATGCATTGGTTAGATGTTGTAATTGGAAG
                      ____________________________________________________________
consensus TATGGATATGGGTATGGCTATGTAAAGGTGCATGCATTGGTTAGATGTTGTAATTGGAAG
 
. : . : . : . : . : . :
rJMSF027N19+ GTCTTGTATTATTAGAAATCCCAGTTATGGTGAAACCATTGCCCTCTTGTTCATGACAAA
                      ____________________________________________________________
consensus GTCTTGTATTATTAGAAATCCCAGTTATGGTGAAACCATTGCCCTCTTGTTCATGACAAA
 
. : . : . : . : . : . :
rJMSF027N19+ AGATTATATGTTGAACTAGCCTCTGGTTTCACTTGGAGAACATGTGAGATTGCTGCCTGC
                      ____________________________________________________________
consensus AGATTATATGTTGAACTAGCCTCTGGTTTCACTTGGAGAACATGTGAGATTGCTGCCTGC