Previous Contig 012563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027L14Sequence541019486704012563 (2)gb:ATAC016827_15436312e-22Arabidopsis thaliana chromosome III BAC F17A9 genomic sequence, complete sequenc
JMSF052D07Sequence622020602gb:AF275345_17825321e-04Lycopersicon esculentum putative permease gene, partial cds; suppressor-like pro926012563 (2)gb:AF466200_18022231e-41Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2, fertil

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052D07+ TTCCATTGCTACTTTTCAAGATGATATAATCATTTGTAATACAGTTGGTCAGGAGGTATT
                      ____________________________________________________________
consensus TTCCATTGCTACTTTTCAAGATGATATAATCATTTGTAATACAGTTGGTCAGGAGGTATT
 
. : . : . : . : . : . :
rJMSF052D07+ AAAGTTCAATAGCAAATCTGGGACTTTATCACCCTTCCAGTTCTCAAATTTTAGCATCCT
                      ____________________________________________________________
consensus AAAGTTCAATAGCAAATCTGGGACTTTATCACCCTTCCAGTTCTCAAATTTTAGCATCCT
 
. : . : . : . : . : . :
rJMSF052D07+ TGGCCTTCCTTATTGGTTCTCATTTCCTATGGAGCGAGTATATGCTACTAAAGATGCACT
                      ____________________________________________________________
consensus TGGCCTTCCTTATTGGTTCTCATTTCCTATGGAGCGAGTATATGCTACTAAAGATGCACT
 
. : . : . : . : . : . :
rJMSF052D07+ ATCAGGACTTCATGTTGATCATGCTGAACTTTTTAACTTGCTGCCAGGTAAAGTTGACAT
                      ____________________________________________________________
consensus ATCAGGACTTCATGTTGATCATGCTGAACTTTTTAACTTGCTGCCAGGTAAAGTTGACAT
 
. : . : . : . : . : . :
rJMSF052D07+ AAAATTGAGTATCGACATACCCAAGTCATTTGAGCTGGTGGAGCCCTTGAATGAAAGTTG
                      ____________________________________________________________
consensus AAAATTGAGTATCGACATACCCAAGTCATTTGAGCTGGTGGAGCCCTTGAATGAAAGTTG
 
. : . : . : . : . : . :
rJMSF052D07+ CATATGGCGCCAAGTTAGAGGAGCAGCAACAGTAGTCTCTGAAGCAGAGAAAGTTTCCAC
rJMSF027L14+ CAAGCTAGAGGTGCAGCAACAGTAGTTTCTGAAGCAGAGAGAATTTCTAC
                      ____________________________________________________________
consensus CATATGGCGCCAAGTTAGAGGTGCAGCAACAGTAGTTTCTGAAGCAGAGAGAGTTTCTAC
 
. : . : . : . : . : . :
rJMSF052D07+ TTCTGAAAAGGTATGCGCTGCCCAACAATGGTACGATGAACTTGACCACCGAACCTTCTG
rJMSF027L14+ TTCTGAAAAGGTATGCGCTGCCCAACAATGGTACGATGAACTTGACCACCGTACTTTCTG
                      ____________________________________________________________
consensus TTCTGAAAAGGTATGCGCTGCCCAACAATGGTACGATGAACTTGACCACCGTACTTTCTG
 
. : . : . : . : . : . :
rJMSF052D07+ GGAATCGGAATTGGAAGTAGAATCAAACAAAGAAGTACACAGCTCAACTGAATCGAGCGT
rJMSF027L14+ GGAATCGGAAT------TAGAATCAAACAAAGAAGTACACAGCTCAACTGAATCAAGCGT
                      ____________________________________________________________
consensus GGAATCGGAATTGGAAGTAGAATCAAACAAAGAAGTACACAGCTCAACTGAATCGAGCGT
 
. : . : . : . : . : . :
rJMSF052D07+ AGAACTGCTTAGCTCAAGTCCTTCGGAAGTTGTGCCAGAAGGGAAAGTTCTCACTGATTG
rJMSF027L14+ AGAAGTGCTTAGCTCAAGTCCTTCAGAAGTTGTGCCGGAAGGGAAAGTTCTCATTGATTG
                      ____________________________________________________________
consensus AGAAGTGCTTAGCTCAAGTCCTTCGGAAGTTGTGCCGGAAGGGAAAGTTCTCATTGATTG
 
. : . : . : . : . : . :
rJMSF052D07+ CTGCATCAACACCAGTCCTGGTACAAGTGAGGTCATTATCTCTGCTGCGCTGTATTTGAA
rJMSF027L14+ CTGCATCAACACCAGTCCTGGTACAAGTGAGGTCATTATTTCCGCTGCACTGTATTTGAA
                      ____________________________________________________________
consensus CTGCATCAACACCAGTCCTGGTACAAGTGAGGTCATTATTTCTGCTGCGCTGTATTTGAA
 
. : . : . : . : . : . :
rJMSF052D07+ ACTGAGGAAGACTGCAGATTCCGGCATGGATAGTCGGGAGCAGAAGGCTGCCAAGATAGC
rJMSF027L14+ ACTGAGGAAGACTGCAGATACCAGAATGGATAGTCGGGAGCAGAAGGCTGCCAAGATAGC
                      ____________________________________________________________
consensus ACTGAGGAAGACTGCAGATTCCGGCATGGATAGTCGGGAGCAGAAGGCTGCCAAGATAGC
 
. : . : . : . : . : . :
rJMSF052D07+ GGATAGTTTGGACCCCACTAGAAGGGTAAGCAAAGATTTGCTCGTTTCATATCTGTTGGC
rJMSF027L14+ GGATAGTTTGGACCCCACAAGAAGGGTAAGCAAAGATTTGCTTGTTTCATATCTGTTGGC
                      ____________________________________________________________
consensus GGATAGTTTGGACCCCACTAGAAGGGTAAGCAAAGATTTGCTTGTTTCATATCTGTTGGC
 
. : . : . : . : . : . :
rJMSF052D07+ ATCAAAAAGAGATTTGGAAGGCCTCATTGTAACTCGACCTTTACAAGTGAGGCTCAAGTT
rJMSF027L14+ ATCAAAAAGAGATTTGGAAGGCATCATTGTTACTCGACCTTTACAAGTGAGGCTCAAGTT
                      ____________________________________________________________
consensus ATCAAAAAGAGATTTGGAAGGCCTCATTGTTACTCGACCTTTACAAGTGAGGCTCAAGTT
 
. : . : . : . : . : . :
rJMSF052D07+ TGAGTGCCCAAACCACCCAACATCAGAAGATAATTCCAAAGAAATTATCATAACTGATTC
rJMSF027L14+ TGAGTGCCCAAACCACCCAACATCAGAAGATAATTCCAAAGAAATTATCATAACTGATTC
                      ____________________________________________________________
consensus TGAGTGCCCAAACCACCCAACATCAGAAGATAATTCCAAAGAAATTATCATAACTGATTC
 
. : . : . : . : . : . :
rJMSF052D07+ TTCTATAGATGTTAGTGTTTCTCTTTTGAACCCATAGTTTCTTACAG
rJMSF027L14+ TTCTTTAAATGTTAGTGTTTCTCTTTTGAACCCATAGTTTCTTACAGACAAGTATTTACT
                      ____________________________________________________________
consensus TTCTTTAGATGTTAGTGTTTCTCTTTTGAACCCATAGTTTCTTACAGACAAGTATTTACT
 
. : . : . : . : . : . :
rJMSF027L14+ TTTAGCATCCTTTGTATTCTTATATTTTTGTAAAAATTTTGGTTTATTGGGGGTAGTGTA
                      ____________________________________________________________
consensus TTTAGCATCCTTTGTATTCTTATATTTTTGTAAAAATTTTGGTTTATTGGGGGTAGTGTA
 
. : . : . : . : . : . :
rJMSF027L14+ CTTTGATGTAAACCAGATCTTACCTCTCATACTTCAAATTTGACTGGTGCAAGACGTTTT
                      ____________________________________________________________
consensus CTTTGATGTAAACCAGATCTTACCTCTCATACTTCAAATTTGACTGGTGCAAGACGTTTT