Previous Contig 012561:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006L09Sequence584012561 (8)pir|T52177|T521773e-58root hairless protein 1 [validated] - Arabidopsis thaliana>gb:AE005173_892797 Ar713012561 (8)gb:AF062372_17652882e-32Arabidopsis thaliana ROOT HAIRLESS 1 (RHL1) gene, complete cds.
JMFF016B15Sequence585012561 (8)pir|T52177|T521773e-58root hairless protein 1 [validated] - Arabidopsis thaliana>gb:AE005173_892797 Ar714012561 (8)gb:AF062372_17652882e-32Arabidopsis thaliana ROOT HAIRLESS 1 (RHL1) gene, complete cds.
JMFF021C04Sequence553012561 (8)pir|T52177|T521772e-56root hairless protein 1 [validated] - Arabidopsis thaliana>gb:AE005173_892797 Ar687012561 (8)gb:AF062372_17652883e-30Arabidopsis thaliana ROOT HAIRLESS 1 (RHL1) gene, complete cds.
JMSF027L05Sequence649012561 (8)pir|T52177|T521775e-64root hairless protein 1 [validated] - Arabidopsis thaliana>gb:AE005173_892797 Ar729012561 (8)gb:AP004670_18430440.019Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021C04- GGTTCCCGCCTTTACTGTTGTGCAAGCTGACTGAGAGATGGTACGG
JMFF006L09- GGTTCCCGCCTTTACTGTTGTGCAAGCTGACTGAGAGATGGTACGG
JMFF016B15- GGTTCCCGCCTTTACTGTTGTGCAAGCTGACTGAGAGATGGTACGG
JMSF027L05- GAGAGTTGGTTCCCGCCTTTACTGTTGTGCAAGCTGACTGAGAGATGGTACGG
                      ____________________________________________________________
consensus GAGAGTTGGTTCCCGCCTTTACTGTTGTGCAAGCTGACTGAGAGATGGTACGG
 
. : . : . : . : . : . :
JMFF021C04- CACGGCGGGAAGAAGGAAGAGAACGCTCCTCCACCGGAAAACCCGGAGGTGGAGGAGCGG
JMFF006L09- CACGGCGGGAAGAAGGAAGAGAACGCTCCTCCACCGGAAAACCCGGAGGTGGAGGAGCGG
JMFF016B15- CACGGCGGGAAGAAGGAAGAGAACGCTCCTCCACCGGAAAACCCGGAGGTGGAGGAGCGG
JMSF027L05- CACGGCGGGAAGAAGGAAGAGAACGCTCCTCCACCGGAAAACCCGGAGGTGGAGGAGCGG
                      ____________________________________________________________
consensus CACGGCGGGAAGAAGGAAGAGAACGCTCCTCCACCGGAAAACCCGGAGGTGGAGGAGCGG
 
. : . : . : . : . : . :
JMFF021C04- AGGAGGCTGAAGAAACTTGCATTCTCGAAGAGGATGCTTTCAGAGACACCTGTGAAGGCG
JMFF006L09- AGGAGGCTGAAGAAACTTGCATTCTCGAAGAGGATGCTTTCAGAGACACCTGTGAAGGCG
JMFF016B15- AGGAGGCTGAAGAAACTTGCATTCTCGAAGAGGATGCTTTCAGAGACACCTGTGAAGGCG
JMSF027L05- AGGAGGCTGAAGAAACTTGCATTCTCGAAGAGGATGCTTTCAGAGACACCTGTGAAGGCG
                      ____________________________________________________________
consensus AGGAGGCTGAAGAAACTTGCATTCTCGAAGAGGATGCTTTCAGAGACACCTGTGAAGGCG
 
. : . : . : . : . : . :
JMFF021C04- GCGACAGCGGCTGGGAATGCTCTGCAACCATCCAAGACAGTGATCAAACATCACGGCAAA
JMFF006L09- GCGACAGCGGCTGGGAATGCTCTGCAACCATCCAAGACAGTGATCAAACATCACGGCAAA
JMFF016B15- GCGACAGCGGCTGGGAATGCTCTGCAACCATCCAAGACAGTGATCAAACATCACGGCAAA
JMSF027L05- GCGACAGCGGCTGGGAATGCTCTGCAACCATCCAAGACAGTGATCAAACATCACGGCAAA
                      ____________________________________________________________
consensus GCGACAGCGGCTGGGAATGCTCTGCAACCATCCAAGACAGTGATCAAACATCACGGCAAA
 
. : . : . : . : . : . :
JMFF021C04- GACCTAATTCGCAAGTCTCAGCGCAGCAAGAGCCGTTTCCTCTTCTCGTTCCCCGGGCTT
JMFF006L09- GACCTAATTCGCAAGTCTCAGCGCAGCAAGAGCCGTTTCCTCTTCTCGTTCCCCGGGCTT
JMFF016B15- GACCTAATTCGCAAGTCTCAGCGCAGCAAGAGCCGTTTCCTCTTCTCGTTCCCCGGGCTT
JMSF027L05- GACCTAATTCGCAAGTCTCAGCGCAGCAAGAGCCGTTTCCTCTTCTCGTTCCCCGGGCTT
                      ____________________________________________________________
consensus GACCTAATTCGCAAGTCTCAGCGCAGCAAGAGCCGTTTCCTCTTCTCGTTCCCCGGGCTT
 
. : . : . : . : . : . :
JMFF021C04- CTCGCCCCCGTTTCTGGTGGCAAAATCGGCGAGCTCAAAGATCTTGGTAGCAAAAACCCT
JMFF006L09- CTCGCCCCCGTTTCTGGTGGCAAAATCGGCGAGCTCAAAGATCTTGGTAGCAAAAACCCT
JMFF016B15- CTCGCCCCCGTTTCTGGTGGCAAAATCGGCGAGCTCAAAGATCTTGGTAGCAAAAACCCT
JMSF027L05- CTCGCCCCCGTTTCTGGTGGCAAAATCGGCGAGCTCAAAGATCTTGGTAGCAAAAACCCT
                      ____________________________________________________________
consensus CTCGCCCCCGTTTCTGGTGGCAAAATCGGCGAGCTCAAAGATCTTGGTAGCAAAAACCCT
 
. : . : . : . : . : . :
JMFF021C04- ATTCTGTACCTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
JMFF006L09- ATTCTGTACCTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
JMFF016B15- ATTCTGTACCTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
JMSF027L05- ATTCTGTACCTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
rJMFF021C04+ CAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
rJMFF006L09+ CTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
rJMFF016B15+ CTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
                      ____________________________________________________________
consensus ATTCTGTACCTCGATTTCCCTCAGGGCCAAATGAAGTTATTTGGGACAATTGTTTATCCA
 
. : . : . : . : . : . :
JMFF021C04- AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
JMFF006L09- AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
JMFF016B15- AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
JMSF027L05- AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
rJMFF021C04+ AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
rJMFF006L09+ AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
rJMFF016B15+ AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
                      ____________________________________________________________
consensus AAAAACAGATATTTGAGTCTGCAGTTCTCCAGAGGCGGGAAGAATGTAGTGTGTGATGAT
 
. : . : . : . : . : . :
JMFF021C04- TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
JMFF006L09- TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
JMFF016B15- TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
JMSF027L05- TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
rJMFF021C04+ TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
rJMFF006L09+ TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
rJMFF016B15+ TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
                      ____________________________________________________________
consensus TACTTTGACAACATGATTGTGTTTTCTGATGCATGGTGGATAGGGAGGAAAGATGAGAAT
 
. : . : . : . : . : . :
JMFF021C04- CCAAATGAAGTGCGTCTTGAGTTCCCC
JMFF006L09- CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
JMFF016B15- CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
JMSF027L05- CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGTGCACCAGAATGCGGAATAT
rJMFF021C04+ CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
rJMFF006L09+ CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
rJMFF016B15+ CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
                      ____________________________________________________________
consensus CCAAATGAAGTGCGTCTTGAGTTCCCCAAGGAGTTGAATGT------GAATGCGGAATAT
 
. : . : . : . : . : . :
JMFF006L09- GATT
JMFF016B15- GATTT
JMSF027L05- GATTTCAAGGGTGGTGCTGGTGCAGCATGTAATGGAAAAGAGGGGATTAACAGAAC
rJMFF021C04+ GATTTCAAGGGTGGT--TGGTGCAGCATGTAATGGAAAAGAGGGGATTAACAGAACAGGG
rJMFF006L09+ GATTTCAAGGGTGGT--TGGTGCAGCATGTAATGGAAAAGAGGGGATTAACAGAACAGGG
rJMFF016B15+ GATTTCAAGGGTGGT--TGGTGCAGCATGTAATGGAAAAGAGGGGATTAACAGAACAGGG
                      ____________________________________________________________
consensus GATTTCAAGGGTGGT--TGGTGCAGCATGTAATGGAAAAGAGGGGATTAACAGAACAGGG
 
. : . : . : . : . : . :
rJMFF021C04+ ATAAATATTGCAGAACAAGAATCTCCTAAACATGAACAAGAAGATGATTCTACAGAAGAT
rJMFF006L09+ ATAAATATTGCAGAACAAGAATCTCCTAAACATGAACAAGAAGATGATTCTACAGAAGAT
rJMFF016B15+ ATAAATATTGCAGAACAAGAATCTCCTAAACATGAACAAGAAGATGATTCTACAGAAGAT
                      ____________________________________________________________
consensus ATAAATATTGCAGAACAAGAATCTCCTAAACATGAACAAGAAGATGATTCTACAGAAGAT
 
. : . : . : . : . : . :
rJMFF021C04+ CAAAGTGATGTCAAAGAATTGTTTGATATAACTCCAAGTCGGCATTCGGCGAGGACAGCT
rJMFF006L09+ CAAAGTGATGTCAAAGAATTGTTTGATATAACTCCAAGTCGGCATTCGGCGAGGACAGCT
rJMFF016B15+ CAAAGTGATGTCAAAGAATTGTTTGATATAACTCCAAGTCGGCATTCGGCGAGGACAGCT
rJMSF027L05+ AGGACAGCT
                      ____________________________________________________________
consensus CAAAGTGATGTCAAAGAATTGTTTGATATAACTCCAAGTCGGCATTCGGCGAGGACAGCT
 
. : . : . : . : . : . :
rJMFF021C04+ AAAAAAACATTCAAATGCTTCTTCTGGCGAAGATTTTGTTGTCAGTGATGCTGAAACTTC
rJMFF006L09+ AAAAAAACATTCAAATGCTTCTTCTGGCGAAGATTTTGTTGTCAGTGATGCTGAAACTTC
rJMFF016B15+ AAAAAAACATTCAAATGCTTCTTCTGGCGAAGATTTTGTTGTCAGTGATGCTGAAACTTC
rJMSF027L05+ AAAAAAACATTCAAATGCTTCTTCTGGCGAAGATTTTGTTGTCAGTGATGCTGAAACTTC
                      ____________________________________________________________
consensus AAAAAAACATTCAAATGCTTCTTCTGGCGAAGATTTTGTTGTCAGTGATGCTGAAACTTC
 
. : . : . : . : . : . :
rJMFF021C04+ AGATGAAGAGGAACAGAAAGTTGGTGTTAATCATTCAAACAGGAACTTTACTTCTAAGAA
rJMFF006L09+ AGATGAAGAGGAACAGAAAGTTGGTGTTAATCATTCAAACAGGAACTTTACTTCTAAGAA
rJMFF016B15+ AGATGAAGAGGAACAGAAAGTTGGTGTTAATCATTCAAACAGGAACTTTACTTCTAAGAA
rJMSF027L05+ AGATGAAGAGGAACAGAAAGTTGGTGTTAATCATTCAAACAGGAACTTTACTTCTAAGAA
                      ____________________________________________________________
consensus AGATGAAGAGGAACAGAAAGTTGGTGTTAATCATTCAAACAGGAACTTTACTTCTAAGAA
 
. : . : . : . : . : . :
rJMSF027L05+ GAAAGAAAAATTGCCTGCTGCAGTCTTTGATGTTGACAAGGATGTAGTTGTTCTAGATCC
                      ____________________________________________________________
consensus GAAAGAAAAATTGCCTGCTGCAGTCTTTGATGTTGACAAGGATGTAGTTGTTCTAGATCC
 
. : . : . : . : . : . :
rJMSF027L05+ ATGTGCTGAGAAAAGTACACCTGGTGCCAAAGTAGCCTCTACATCCAAGGAGCTTCCTCA
                      ____________________________________________________________
consensus ATGTGCTGAGAAAAGTACACCTGGTGCCAAAGTAGCCTCTACATCCAAGGAGCTTCCTCA
 
. : . : . : . : . : . :
rJMSF027L05+ CAGTAATCACAGTTCTCTTGTTCAAGCAACTATATCTACTATGTTTAAGAAAGTGGAGGA
                      ____________________________________________________________
consensus CAGTAATCACAGTTCTCTTGTTCAAGCAACTATATCTACTATGTTTAAGAAAGTGGAGGA
 
. : . : . : . : . : . :
rJMSF027L05+ GAAGAAGGAGCTTACAGATCTAAAACAGAAGATTGTTCATAAGAATGTTGCATCGTCCAA
                      ____________________________________________________________
consensus GAAGAAGGAGCTTACAGATCTAAAACAGAAGATTGTTCATAAGAATGTTGCATCGTCCAA
 
. : . : . : . : . : . :
rJMSF027L05+ GAAGAAGGGGAAAGTGGGTGAAGAAACTAAAGCTGGGAGACGGATGACAACAACAAAAAA
                      ____________________________________________________________
consensus GAAGAAGGGGAAAGTGGGTGAAGAAACTAAAGCTGGGAGACGGATGACAACAACAAAAAA
 
. : . : . : . : . : . :
rJMSF027L05+ GCAGCTTGAGGCTGAAGATGAAGAGATAGAAGAGTTCTCCAGTACATCTCAGGATATGGA
                      ____________________________________________________________
consensus GCAGCTTGAGGCTGAAGATGAAGAGATAGAAGAGTTCTCCAGTACATCTCAGGATATGGA
 
. : . : . : . : . : . :
rJMSF027L05+ CATGGATGGAAGTGATGAAGATTGGACTGCTTGAGATTTTTTCTGCCATTGCTATGATCA
                      ____________________________________________________________
consensus CATGGATGGAAGTGATGAAGATTGGACTGCTTGAGATTTTTTCTGCCATTGCTATGATCA
 
. : . : . : . : . : . :
rJMSF027L05+ TATGGTAAACATTGGTTTATATTACTGCGGTTTACAAATTAGCTATTGGCTTCTCAGAGA
                      ____________________________________________________________
consensus TATGGTAAACATTGGTTTATATTACTGCGGTTTACAAATTAGCTATTGGCTTCTCAGAGA
 
. : . : . : . : . : . :
rJMSF027L05+ ATAGATAATAGTGCAAATATTGTCTTTCAAAAGCTTTGTAGACATTAGGGAAAAGTTACA
                      ____________________________________________________________
consensus ATAGATAATAGTGCAAATATTGTCTTTCAAAAGCTTTGTAGACATTAGGGAAAAGTTACA
 
. : . : . : . : . : . :
rJMSF027L05+ GAAATTGTTGTCATGCTTAGAAAGAGGATTGACTTTCAGGAATATTTTTTGATTCAAATC
                      ____________________________________________________________
consensus GAAATTGTTGTCATGCTTAGAAAGAGGATTGACTTTCAGGAATATTTTTTGATTCAAATC