Previous Contig 012547:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010J02Sequence390012547 (5)pir|E96570|E965701e-29hypothetical protein F14G24.19 [imported] - Arabidopsis thaliana>gb:AE005173_893630012547 (5)gb:AE016959_10232641e-69Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF027G13Sequence665012547 (5)pir|E96570|E965709e-41hypothetical protein F14G24.19 [imported] - Arabidopsis thaliana>gb:AE005173_893792012547 (5)gb:AE016959_10232642e-91Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06
JMSF028G13Sequence622005633 (9)pir|T51518|T515186e-57ubiquitin-fusion degradation protein-like - Arabidopsis thaliana>gb:ATT20K14_155707012547 (5)gb:AE016959_10232647e-82Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC06

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027G13- GGTAGGAAATAT
                      ____________________________________________________________
consensus GGTAGGAAATAT
 
. : . : . : . : . : . :
JMSF027G13- TCCACACTGCCTCGAAGGGCGAATCTCTGTGCGGTAATTCCATCTTCTCCGAGAACTAAC
                      ____________________________________________________________
consensus TCCACACTGCCTCGAAGGGCGAATCTCTGTGCGGTAATTCCATCTTCTCCGAGAACTAAC
 
. : . : . : . : . : . :
JMSF010J02- GGGGATAGTTGATTCAGGA
JMSF027G13- TACAAAATCTAAAACAAAAAAGCAAACAATTTCGTCCCAGAGGGGATAGTTGATTCAGGA
                      ____________________________________________________________
consensus TACAAAATCTAAAACAAAAAAGCAAACAATTTCGTCCCAGAGGGGATAGTTGATTCAGGA
 
. : . : . : . : . : . :
JMSF010J02- AATGGCAGACCGTTTCTTTCCGAACGAAATGCCTAATTTCATCCCAGAAACCGCAGAGGC
JMSF027G13- AATGGCAGACCGTTTCTTTCCGAACGAAATGCCTAATTTCATCCCAGAAACCGCAGAGGC
                      ____________________________________________________________
consensus AATGGCAGACCGTTTCTTTCCGAACGAAATGCCTAATTTCATCCCAGAAACCGCAGAGGC
 
. : . : . : . : . : . :
JMSF010J02- AGAAGAGCTAGCGGAAAAAGCGCAAGACTCACTCACTAAGCTTCTACATCTTCCTTACAA
JMSF027G13- AGAAGAGCTAGCGGAAAAAGCGCAAGACTCACTCACTAAGCTTCTACATCTTCCTTACAA
                      ____________________________________________________________
consensus AGAAGAGCTAGCGGAAAAAGCGCAAGACTCACTCACTAAGCTTCTACATCTTCCTTACAA
 
. : . : . : . : . : . :
JMSF010J02- GAACGTCGCGAAGAAAATACAAAAATCTGCTTTGGTGCTTAAAGAAAAGATTGTGGAGGA
JMSF027G13- GAACGTCGCGAAGAAAATACAAAAATCTGCTTTGGTGCTTAAAGAAAAGATTGTGGAGGA
                      ____________________________________________________________
consensus GAACGTCGCGAAGAAAATACAAAAATCTGCTTTGGTGCTTAAAGAAAAGATTGTGGAGGA
 
. : . : . : . : . : . :
JMSF010J02- GACGTGGGTAGCTAAGGGGAAACGCGTGAGTGACTATTCACTGTACACTGGGGCTCTGGG
JMSF027G13- GACGTGGGTAGCTAAGGGGAAACGCGTGAGTGACTATTCACTGTACACTGGGGCTCTGGG
                      ____________________________________________________________
consensus GACGTGGGTAGCTAAGGGGAAACGCGTGAGTGACTATTCACTGTACACTGGGGCTCTGGG
 
. : . : . : . : . : . :
JMSF010J02- CACTGCTTTCTTGTTGTTTAAAGCTTACCAAGTTAGCAAAGACAGGAATGATCTTGCTTT
JMSF027G13- CACTGCTTTCTTGTTGTTTAAAGCTTACCAAGTTAGCAAAGACAGGAATGATCTTGCTTT
                      ____________________________________________________________
consensus CACTGCTTTCTTGTTGTTTAAAGCTTACCAAGTTAGCAAAGACAGGAATGATCTTGCTTT
 
. : . : . : . : . : . :
JMSF010J02- GTGCTTGGAGATAACCAGTGCTTGTGATCTTGCTTCTCGCGGTTCTGGGCGGGTCACATT
JMSF027G13- GTGCTTGGAGATAACCAGTGCTTGTGATCTTGCTTCTCGCGGTTCTGGGCGGGTCACATT
                      ____________________________________________________________
consensus GTGCTTGGAGATAACCAGTGCTTGTGATCTTGCTTCTCGCGGTTCTGGGCGGGTCACATT
 
. : . : . : . : . : . :
JMSF010J02- CATATGTGG
JMSF027G13- CATATGTGGGCAGGCGGGTGTATGTGCCCTTGGTTCAGTTGTGGCAATGCACATTGGCAA
rJMSF027G13+ TGGCAA
                      ____________________________________________________________
consensus CATATGTGGGCAGGCGGGTGTATGTGCCCTTGGTTCAGTTGTGGCAATGCACATTGGCAA
 
. : . : . : . : . : . :
JMSF027G13- TGAACGGTTATGTAGCCATTACTTGGCGCAATTTAAGGAGCGAGCAGTAGTGGATGATGT
rJMSF027G13+ TGAACNGTTATGTAGCCA-TACTNGGCGCAATTTAAGGAGCGAGCAGTAGTGGATGATGT
                      ____________________________________________________________
consensus TGAACGGTTATGTAGCCATTACTTGGCGCAATTTAAGGAGCGAGCAGTAGTGGATGATGT
 
. : . : . : . : . : . :
JMSF027G13- TATAAGATCTGGCCATAAAATGGCGACNGGGAGATGCCCTTTGATGTATGAGT
rJMSF028G13+ CATAAAATGGCGACANGGAGATGCCNTTTGATGTATGAGTGGCATGG
rJMSF027G13+ TATAAGATCTGGCCATAAAATGGCGACAGGGAGATGCCCTTTGATGTATGAGTGGCATGG
                      ____________________________________________________________
consensus TATAAGATCTGGCCATAAAATGGCGACAGGGAGATGCCCTTTGATGTATGAGTGGCATGG
 
. : . : . : . : . : . :
rJMSF028G13+ GAAAAAATACTGGGGGGCTGCCCATGGTCTGGCTGGTANTATGCATGTATTGATGGACAT
rJMSF010J02+ CCCATGGTCTGGCTGGTATTATGCANGTATNGANGGACAN
rJMSF027G13+ GAAAAAATACTGGGGGGCTGCCCATGGTCTGGCTGGTATTATGCATGTATTGATGGACAT
                      ____________________________________________________________
consensus GAAAAAATACTGGGGGGCTGCCCATGGTCTGGCTGGTATTATGCATGTATTGATGGACAT
 
. : . : . : . : . : . :
rJMSF028G13+ GGAACTGNANCCGGATGAGCTGGAGGATATCAAGTGCACCNTGCGTTNTATGATCAGGAA
rJMSF010J02+ GGAACTGAAACCGGATGAGCTGGAGGATATCAAGTGCACCCTGCGTTTTATGATCAGGAA
rJMSF027G13+ GGAACTGAAACCGGATGAGCTGGAGGATATCAAGTGCACCCTGCGTTTTATGATCAGGAA
                      ____________________________________________________________
consensus GGAACTGAAACCGGATGAGCTGGAGGATATCAAGTGCACCCTGCGTTTTATGATCAGGAA
 
. : . : . : . : . : . :
rJMSF028G13+ CCGCTTTCCTANTGGGAATTACCCTTCAAGNGAAGGAAATGAATCAGATCGTCTTGTGCA
rJMSF010J02+ CCGCTTTCCTAGTGGGAATTACCCTTCAAGTGAAGGAAATGAATCAGATCGTCTTGTGCA
rJMSF027G13+ CCGCTTTCCTAGTGGGAATTACCCTTCAAGTGAAGGAAATGAATCAGATCGTCTTGTGCA
                      ____________________________________________________________
consensus CCGCTTTCCTAGTGGGAATTACCCTTCAAGTGAAGGAAATGAATCAGATCGTCTTGTGCA
 
. : . : . : . : . : . :
rJMSF028G13+ TTGGTGCCATGGTGCTCCTGGCCTTGCTCTTACTCTTACAAAGGCAGCAAAGGTTTTTAA
rJMSF010J02+ TTGGTGCCATGGTGCTCCTGGCCTTGCTCTTACTCTTACAAAGGCAGCAAAGGTTTTTAA
rJMSF027G13+ TTGGTGCCATGGTGCTCCTGGCCTTGCTCTTACTCTTACAAAGGCAGCAAAGGTTTTTAA
                      ____________________________________________________________
consensus TTGGTGCCATGGTGCTCCTGGCCTTGCTCTTACTCTTACAAAGGCAGCAAAGGTTTTTAA
 
. : . : . : . : . : . :
rJMSF028G13+ CAGTGAGGAGTTTCTTCAAGCAGCTGTAGATGCAGCTGAGGTGGTCTGGAATCGGGGACT
rJMSF010J02+ CAGTGNGGAGTTTCTTCAAGCAGCTGTAGATGCAGCTGAGGTGGTCTGGAATCGGGGACT
rJMSF027G13+ CAGTGAGGAGTTTCTTCAAGCAGCTGTAGATGCAGCTGAGGTGGTCTGGAATCGGGGACT
                      ____________________________________________________________
consensus CAGTGAGGAGTTTCTTCAAGCAGCTGTAGATGCAGCTGAGGTGGTCTGGAATCGGGGACT
 
. : . : . : . : . : . :
rJMSF028G13+ ACTAAAACGAGTTGGTATTTGTCACGGTATCAGTGGGAACTCGTATGTATTTCTTGCACT
rJMSF010J02+ ACTAAAACGAGTTGGTATTTGTCACGGTATCAGTGGGAACTCGTATGTATTTCTTGCACT
rJMSF027G13+ ACTAAAACGAGTTGGTATTTGTCACGGTATCAGTGGGAACTCGTATGTATTTCTTGCACT
                      ____________________________________________________________
consensus ACTAAAACGAGTTGGTATTTGTCACGGTATCAGTGGGAACTCGTATGTATTTCTTGCACT
 
. : . : . : . : . : . :
rJMSF028G13+ TTACCGATTAACAGGTGACATGAAATATTTGTNCCGGGCAAAGGCATTTGCTTGCTTTCT
rJMSF010J02+ TTACCGATTAACAGGTGACATGAAATATTTGTACCGGGCAAAGGCATTTGCTTGCTTTCT
rJMSF027G13+ TTACCGATTAACAGGTGACATGAAATATTTGTACCGGGCAAAGGCATTTGCTTGCTTTCT
                      ____________________________________________________________
consensus TTACCGATTAACAGGTGACATGAAATATTTGTACCGGGCAAAGGCATTTGCTTGCTTTCT
 
. : . : . : . : . : . :
rJMSF028G13+ GCACAATAGAGCTCAAACTCTTATATCAGAGGGAANTATGCATGGCGGTGATCGTCCATA
rJMSF010J02+ GCACAATAGAGCTCAAACTCTTATATCAGAGGGAATTATGCATGGCGGTGATCGTCCATA
rJMSF027G13+ GCACAATAGAGCTCAAACTCTTATATCAGAGGGAATTATGCATGGCGGTGATCGTCCATA
                      ____________________________________________________________
consensus GCACAATAGAGCTCAAACTCTTATATCAGAGGGAATTATGCATGGCGGTGATCGTCCATA
 
. : . : . : . : . : . :
rJMSF028G13+ CTCACTATTTNAAGGCATTGGGGGTATGGCTTATCTCTTTCNGGNCATGACAGAACCGCT
rJMSF010J02+ CTCACTATTTGAAGGCATTGGGGGTATGGCTTATCTCTTTCTGGACATGACAGAACCGCT
rJMSF027G13+ CTCACTATTTGAAGGCATTGGGGGTATGGCTTATCTCTTTCTGGACATGACAGAACCGCT
                      ____________________________________________________________
consensus CTCACTATTTGAAGGCATTGGGGGTATGGCTTATCTCTTTCTGGACATGACAGAACCGCT
 
. : . : . : . : . : . :
rJMSF028G13+ TGACACAAGGTTCCCTGCTTATGAACTTCAGTTCTATGCAAAATATAATGAAGTGTTTAT
rJMSF010J02+ TGACACAAGGTTCCCTGCTTATGAACTTTAGTTCTATGCAAAATATAATGAAGTGTTTAT
rJMSF027G13+ TGACACAAGGTTCCCTGCTTATGAACTTTAGTTCTATGCAAAATATAATGAAGTGTTTAT
                      ____________________________________________________________
consensus TGACACAAGGTTCCCTGCTTATGAACTTTAGTTCTATGCAAAATATAATGAAGTGTTTAT
 
. : . : . : . : . : . :
rJMSF028G13+ ACTTGATATGAACTGTCTTGTTATCTGTTTAGTGTTCCGNAATGCTGCGATGTTTAGTTT
rJMSF010J02+ ACNTGATATG-ACTGTCNTGTTATCTGTTTAGTGTTCCGAAATGC
rJMSF027G13+ ACTTGATATG-ACTGTCTTGTTATCTGTTTAGTGTTCCGAAATGCTGCGATGTTTAGTTT
                      ____________________________________________________________
consensus ACTTGATATG-ACTGTCTTGTTATCTGTTTAGTGTTCCGAAATGCTGCGATGTTTAGTTT