Previous Contig 012545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027G01Sequence678012545 (4)sp|P49227|RL5_ARATH2e-8660S ribosomal protein L5.>gb:AB016876_1512972 Arabidopsis thaliana genomic DNA, 751012545 (4)gb:AY365248_16028816e-89Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.
JMSF030G04Sequence288012545 (4)747012545 (4)gb:AY365248_16028812e-81Cucumis sativus 60S ribosomal protein L5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030G04- GA
JMSF027G01- GA
                      ____________________________________________________________
consensus GA
 
. : . : . : . : . : . :
JMSF030G04- GAGTTCAGACGCAGCTCTGAAAGCTAATATTGTAGCGGTCTCTCTTTCGCAGCTCCAATG
JMSF027G01- GAGTTCAGACGCAGCTCTGAAAGCTAATATTGTAGCGGTCTCTCTTTCGCAGCTCCAATG
                      ____________________________________________________________
consensus GAGTTCAGACGCAGCTCTGAAAGCTAATATTGTAGCGGTCTCTCTTTCGCAGCTCCAATG
 
. : . : . : . : . : . :
JMSF030G04- G
JMSF027G01- GCCTTTGTCAAGCTTCAGAAGACGAGGGCATACTTCAAGAGGTTTCAGGTTCAGTTCAAG
                      ____________________________________________________________
consensus GCCTTTGTCAAGCTTCAGAAGACGAGGGCATACTTCAAGAGGTTTCAGGTTCAGTTCAAG
 
. : . : . : . : . : . :
JMSF027G01- AGAAGAAGAGATGGGAAGACTGATTACCGTGCCCGTGTTCGACTTATTAACCAAGATAAG
                      ____________________________________________________________
consensus AGAAGAAGAGATGGGAAGACTGATTACCGTGCCCGTGTTCGACTTATTAACCAAGATAAG
 
. : . : . : . : . : . :
JMSF027G01- AACAAGTACAACACTCCCAAGTATCGTTTTGTTGTGCGATTTACCAACAAAGATATTGTT
                      ____________________________________________________________
consensus AACAAGTACAACACTCCCAAGTATCGTTTTGTTGTGCGATTTACCAACAAAGATATTGTT
 
. : . : . : . : . : . :
JMSF027G01- GCACAAATAGTGTCTGCCAGCATTGCTGGTGATATCATCCTTGCTGCAGCATACTCTCAT
                      ____________________________________________________________
consensus GCACAAATAGTGTCTGCCAGCATTGCTGGTGATATCATCCTTGCTGCAGCATACTCTCAT
 
. : . : . : . : . : . :
JMSF027G01- GAATTGCCTCGATATGGGCTTGAAGTAGGTCTGACGAATTATGCAGCAGCCTACTGCACT
rJMSF027G01+ CTGACGAATTATGCAGCAGCCTACTGCACT
                      ____________________________________________________________
consensus GAATTGCCTCGATATGGGCTTGAAGTAGGTCTGACGAATTATGCAGCAGCCTACTGCACT
 
. : . : . : . : . : . :
JMSF027G01- GGGCTTCTTTTAGCACGGCGGGTCTTGAAAACGCTTGAGATGGATGATGATTATGAAGGC
rJMSF030G04+ TATGAAGGC
rJMSF027G01+ GGGCTTCTTTTAGCACGGCGGGTCTTGAAAACGCTTGAGATGGATGATGATTATGAAGGC
                      ____________________________________________________________
consensus GGGCTTCTTTTAGCACGGCGGGTCTTGAAAACGCTTGAGATGGATGATGATTATGAAGGC
 
. : . : . : . : . : . :
JMSF027G01- AATGTGGAGGCTACCGGTGAGGACTTTTCTGTTGAGCCAGGTGAGAGCAGAAGACCCTTC
rJMSF030G04+ AATGTGGAGGCTACCGGTGAGGACTTTTCTGTTGAGCCAGGTGAGAGCAGAAGACCCTTC
rJMSF027G01+ AATGTGGAGGCTACCGGTGAGGACTTTTCTGTTGAGCCAGGTGAGAGCAGAAGACCCTTC
                      ____________________________________________________________
consensus AATGTGGAGGCTACCGGTGAGGACTTTTCTGTTGAGCCAGGTGAGAGCAGAAGACCCTTC
 
. : . : . : . : . : . :
JMSF027G01- CGTGCTCTCCTTGATGTTGGTCTAATCAGAACAACAACTGGAAACCGTGTTTTTGGTGCA
rJMSF030G04+ CGTGCTCTCCTTGATGTTGGTCTAATCAGAACAACAACTGGAAACCGTGTTTTTGGTGCA
rJMSF027G01+ CGTGCTCTCCTTGATGTTGGTCTAATCAGAACAACAACTGGAAACCGTGTTTTTGGTGCA
                      ____________________________________________________________
consensus CGTGCTCTCCTTGATGTTGGTCTAATCAGAACAACAACTGGAAACCGTGTTTTTGGTGCA
 
. : . : . : . : . : . :
JMSF027G01- CTTAAGGGAGCATTGGATGGTGGTCTTGATATTCCTCACAGTGACAAGAGATTTGCTGGA
rJMSF030G04+ CTTAAGGGAGCATTGGATGGTGGTCTTGATATTCCTCACAGTGACAAGAGATTTGCTGGA
rJMSF027G01+ CTTAAGGGAGCATTGGATGGTGGTCTTGATATTCCTCACAGTGACAAGAGATTTGCTGGA
                      ____________________________________________________________
consensus CTTAAGGGAGCATTGGATGGTGGTCTTGATATTCCTCACAGTGACAAGAGATTTGCTGGA
 
. : . : . : . : . : . :
JMSF027G01- TTCTCAAAAGACTCCAAGCAGCTCGATGCTGAGCTTCATCGGAAATACATTTATGGTGGC
rJMSF030G04+ TTCTCAAAAGACTCCAAGCAGCTCGATGCTGAGCTTCATCGGAAATACATTTATGGTGGC
rJMSF027G01+ TTCTCAAAAGACTCCAAGCAGCTCGATGCTGAGCTTCATCGGAAATACATTTATGGTGGC
                      ____________________________________________________________
consensus TTCTCAAAAGACTCCAAGCAGCTCGATGCTGAGCTTCATCGGAAATACATTTATGGTGGC
 
. : . : . : . : . : . :
JMSF027G01- CATGTTGCTGGATATA
rJMSF030G04+ CATGTTGCTGGATATATGAAGACATTGATGGAAGATGAGCCAGAGAAGTATCAGTCACAC
rJMSF027G01+ CATGTTGCTGGATATATGAAGACATTGATGGAAGATGAGCCAGAGAAGTATCAGTCACAC
                      ____________________________________________________________
consensus CATGTTGCTGGATATATGAAGACATTGATGGAAGATGAGCCAGAGAAGTATCAGTCACAC
 
. : . : . : . : . : . :
rJMSF030G04+ TTCAGCGAATATGTCAAGAAAGGTATCGAGGCAGATAACATAGAGGAGGTTTATAAGAAA
rJMSF027G01+ TTCAGCGAATATGTCAAGAAAGGTATCGAGGCAGATAACATAGAGGAGGTTTATAAGAAA
                      ____________________________________________________________
consensus TTCAGCGAATATGTCAAGAAAGGTATCGAGGCAGATAACATAGAGGAGGTTTATAAGAAA
 
. : . : . : . : . : . :
rJMSF030G04+ GTCCATGCTGCCATTCGTGCTGATCCAACAGCTAAGAAGTCAGATAAGCCGCAGCCTAAG
rJMSF027G01+ GTCCATGCTGCCATTCGTGCTGATCCAACAGCTAAGAAGTCAGATAAGCCGCAGCCTAAG
                      ____________________________________________________________
consensus GTCCATGCTGCCATTCGTGCTGATCCAACAGCTAAGAAGTCAGATAAGCCGCAGCCTAAG
 
. : . : . : . : . : . :
rJMSF030G04+ GAGCACAAGAGGTTCAATTTGAAGAAACTCACCTATGACGAGAGGAGGGCTAACCTGATT
rJMSF027G01+ GAGCACAAGAGGTTCAATTTGAAGAAACTCACCTATGACGAGAGGAGGGCTAACCTGATT
                      ____________________________________________________________
consensus GAGCACAAGAGGTTCAATTTGAAGAAACTCACCTATGACGAGAGGAGGGCTAACCTGATT
 
. : . : . : . : . : . :
rJMSF030G04+ GAGCGCCTAAATGCTCTTAACGCTGCAGCAGGACAAGACGAAGACGAAGATGAAGACGAT
rJMSF027G01+ GAGCGCCTAAATGCTCTTAACGCTGCAGCAGGACAAGACGAAGACGAAGATGAAGACGAT
                      ____________________________________________________________
consensus GAGCGCCTAAATGCTCTTAACGCTGCAGCAGGACAAGACGAAGACGAAGATGAAGACGAT
 
. : . : . : . : . : . :
rJMSF030G04+ GAGTGAAAACACTAGATTGCGCAAGCGATTCTATGCAGTTCTTAGACCTATTAGATCAAA
rJMSF027G01+ GAGTGAAAACACTAGATTGCGCAAGCGATTCTATGCAGTTCTTAGACCTATTAGATCAAA
                      ____________________________________________________________
consensus GAGTGAAAACACTAGATTGCGCAAGCGATTCTATGCAGTTCTTAGACCTATTAGATCAAA
 
. : . : . : . : . : . :
rJMSF030G04+ GTTTTGTTACACCCATTCTGGGGAATTTTGGGTTATACTATGTCAGATTTTGAGTTGG
rJMSF027G01+ GTTTTGTTACACCCATTCTGGGGAATTTTGGGTTATACTATGTCAGATTTTGAGTTGGAT
                      ____________________________________________________________
consensus GTTTTGTTACACCCATTCTGGGGAATTTTGGGTTATACTATGTCAGATTTTGAGTTGGAT