Previous Contig 012543:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049D19Sequence634005190 (5)599012543 (6)gb:AP004729_18438762e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF027F23Sequence647006447 (5)gb:AP005797_18579487e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B113735012543 (6)gb:AP004729_18438763e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF028K23Sequence655006447 (5)gb:AP005797_18579481e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B113665012543 (6)gb:AP004729_18438761e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF029A08Sequence648006447 (5)gb:AP005797_18579484e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B113750012543 (6)gb:AP004729_18438763e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF043G11Sequence771006447 (5)gb:AP005797_18579484e-96Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B113826012543 (6)gb:AP004729_18438762e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF046O09Sequence683006447 (5)gb:AP005797_18579486e-88Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B113574012543 (6)gb:AP004729_18438761e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028K23+ GGA
                      ____________________________________________________________
consensus GGA
 
. : . : . : . : . : . :
rJMSF028K23+ ACCACCAAAGAAAGAAGAGCCAAAATCTGAGGTAGGAGAAGAGGAAGAAGCACCAAAGCC
rJMSF029A08+ GAAGAAGCACCAAAGCC
rJMSF043G11+ GAAGAAGCACCAAAGCC
rJMFF049D19+ TAGGAGAAGAGGAAGAAGCACCAAAGCC
rJMSF027F23+ AAGAAAGAAGAGCCAAAATCTGAGGTAGGAGAAGAGGAAGAAGCACCAAAGCC
                      ____________________________________________________________
consensus ACCACCAAAGAAAGAAGAGCCAAAATCTGAGGTAGGAGAAGAGGAAGAAGCACCAAAGCC
 
. : . : . : . : . : . :
rJMSF028K23+ CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
rJMSF029A08+ CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
rJMSF043G11+ CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
rJMFF049D19+ CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
rJMSF046O09+ CCTCCCAGTAAGATGATTCTAGATGAATGGAA
rJMSF027F23+ CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
                      ____________________________________________________________
consensus CAAGCCAAAGAATCCTCTTGATCTTTTGCCTCCCAGTAAGATGATTCTAGATGAATGG-A
 
. : . : . : . : . : . :
rJMSF028K23+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
rJMSF029A08+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
rJMSF043G11+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
rJMFF049D19+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
rJMSF046O09+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
rJMSF027F23+ AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
                      ____________________________________________________________
consensus AGAGGCTCTACTCAAACACTAAGACCAACTTCCAGGAATTTGCCATCAAAGGTTTTTGGG
 
. : . : . : . : . : . :
rJMSF028K23+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
rJMSF029A08+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
rJMSF043G11+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
rJMFF049D19+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
rJMSF046O09+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
rJMSF027F23+ ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
                      ____________________________________________________________
consensus ATATGTATGATCCCGAGGGGTACTCACTCTGGTTCTGTGATTACAAGTACAATGATGAGA
 
. : . : . : . : . : . :
rJMSF028K23+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
rJMSF029A08+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
rJMSF043G11+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
rJMFF049D19+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
rJMSF046O09+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
rJMSF027F23+ ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
                      ____________________________________________________________
consensus ACACTGTTTCTTTTGTAACATCGAACAAGGTGAGCGGTTTTCTTCAGAGAATGGATCTGG
 
. : . : . : . : . : . :
rJMSF028K23+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
rJMSF029A08+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
rJMSF043G11+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
rJMFF049D19+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
rJMSF046O09+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
rJMSF027F23+ CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
                      ____________________________________________________________
consensus CACGCAAGTATGCATTTGGCAAAATGTTGGTGATTGGTTCACAGCCTCCCTTCAAGGTGA
 
. : . : . : . : . : . :
rJMSF028K23+ ATGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
rJMSF029A08+ AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
rJMSF043G11+ AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
rJMFF049D19+ AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
rJMSF046O09+ AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
rJMSF027F23+ AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
                      ____________________________________________________________
consensus AGGGGTTGTGGCTCTTCCGTGGCAAAGAAATTCCAAAGTTCATTATGGATGAAGTCTATG
 
. : . : . : . : . : . :
rJMSF028K23+ ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
rJMSF029A08+ ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
rJMSF043G11+ ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
rJMFF049D19+ ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
rJMSF046O09+ ACATGGAGCTGTATGAGTAGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
rJMSF027F23+ ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
                      ____________________________________________________________
consensus ACATGGAGCTGTATGAGTGGAGGGAAGCAGACATCAACGATGAAGCTCAGAAAGAGCGTG
 
. : . : . : . : . : . :
rJMSF028K23+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
rJMSF029A08+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
rJMSF043G11+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
rJMFF049D19+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
rJMSF046O09+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
rJMSF027F23+ TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
                      ____________________________________________________________
consensus TCAACCAGATGATTGTGGACCACGAGCCTTTTGAAGGTGAGGATCTTTTGGATGCTAAGT
 
. : . : . : . : . : . :
rJMSF028K23+ GTTTCCCCTTATCTCTAGTTTCTAGTGCTACTTAATTTTGTCCTGCAAGTTACTATTTCC
rJMSF029A08+ GTTTC
rJMSF043G11+ GTTTC
rJMFF049D19+ GTTTCCCCTTATCTCTAGTTTCTAGTGCTACTTAATTTTGTCCTGCAAGTTACTATTTCC
rJMSF046O09+ GTTTCCCCTTATCTCTAGTTTCTAGTGCTACTTAATTTTGTCCTGCAAGTTACTATTTCC
rJMSF027F23+ GTTTCCCCTTATCTCTAGTTTCTAGTGCTACTTAATTTTGTCCTGCAAGTTACTATTTCC
                      ____________________________________________________________
consensus GTTTCCCCTTATCTCTAGTTTCTAGTGCTACTTAATTTTGTCCTGCAAGTTACTATTTCC
 
. : . : . : . : . : . :
rJMSF028K23+ TTCTTCATTTATAATGTGATTTCTTTCACCCCAAACAATTACTGCTCTGTGATTCAAATT
rJMFF049D19+ TTCTTCATTTATAATGTGATTTCTTTCACCCC
rJMSF046O09+ TTCTTCATTTATAATGTGATTTCTTTCACCCCAAACAATTACTGCTCTGTGATTCAAATT
rJMSF027F23+ TTCTTCATTTATAATGTGATTTCTTTCACCCCAAACAATTACTGCTCTGTGATTCAAATT
                      ____________________________________________________________
consensus TTCTTCATTTATAATGTGATTTCTTTCACCCCAAACAATTACTGCTCTGTGATTCAAATT
 
. : . : . : . : . : . :
rJMSF028K23+ TAT
rJMSF046O09+ TA
rJMSF027F23+ TATGTTTTTGACTTTGATCTATTATACCAAGCAGTAAAAGCAAGTTCATGACCAATATGC
                      ____________________________________________________________
consensus TATGTTTTTGACTTTGATCTATTATACCAAGCAGTAAAAGCAAGTTCATGACCAATATGC