Previous Contig 012540:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005A09Sequence238018397gb:AY735719_16257618e-06Arabidopsis thaliana hypothetical protein AT5G51920 mRNA, complete cds.393012540 (4)gb:AY585866_16163274e-25Digitalis parviflora progesterone 5-beta-reductase gene, complete cds.
JMSF005C11Sequence335012540 (4)gb:DOB555127_16759913e-36Digitalis obscura p5Br gene for putative progesterone 5-beta-reductase, exons 1-115013591 (4)
JMSF027F12Sequence639012540 (4)gb:DOB555127_16759911e-74Digitalis obscura p5Br gene for putative progesterone 5-beta-reductase, exons 1-741012540 (4)gb:AY585866_16163271e-85Digitalis parviflora progesterone 5-beta-reductase gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027F12- GACCAAATAAATCTGCCACACGTTTC
                      ____________________________________________________________
consensus GACCAAATAAATCTGCCACACGTTTC
 
. : . : . : . : . : . :
JMSF027F12- CACTTTAAGTGATCTGCGTAGAGATTCCGACGATGAGCTGGTGGTGGGCCGGCGCCATTG
                      ____________________________________________________________
consensus CACTTTAAGTGATCTGCGTAGAGATTCCGACGATGAGCTGGTGGTGGGCCGGCGCCATTG
 
. : . : . : . : . : . :
JMSF005C11- CACCAGAGCGTGG
JMSF027F12- GTGCTGCCAAGAAAAGGTTTGGAGAAGAAGATGACGCGCCACCCAAACACCAGAGCGTGG
                      ____________________________________________________________
consensus GTGCTGCCAAGAAAAGGTTTGGAGAAGAAGATGACGCGCCACCCAAACACCAGAGCGTGG
 
. : . : . : . : . : . :
JMSF005C11- CTCTAATCCTCGGCGTTACCGGCATAGTCGGCAACAGCCTCGCCGAGATCCTCCCTCTGG
JMSF027F12- CTCTAATCCTCGGCGTTACCGGCATAGTCGGCAACAGCCTCGCCGAGATCCTCCCTCTGG
                      ____________________________________________________________
consensus CTCTAATCCTCGGCGTTACCGGCATAGTCGGCAACAGCCTCGCCGAGATCCTCCCTCTGG
 
. : . : . : . : . : . :
JMSF005C11- CTGACACGCCCGGCGGCCCATGGAAGGTTTACGGCGTCGCTCGCCGACCAAGACCCGCCT
JMSF027F12- CTGACACGCCCGGCGGCCCATGGAAGGTTTACGGCGTCGCTCGCCGACCAAGACCCGCCT
                      ____________________________________________________________
consensus CTGACACGCCCGGCGGCCCATGGAAGGTTTACGGCGTCGCTCGCCGACCAAGACCCGCCT
 
. : . : . : . : . : . :
JMSF005C11- GGAACGCCGACCACCCTATCCAGTATATCCAGTGCGATATTTCCGCCGAGGAAGACGCCC
JMSF027F12- GGAACGCCGACCACCCTATCCAGTATATCCAGTGCGATATTTCCGCCGAGGAAGACGCCC
                      ____________________________________________________________
consensus GGAACGCCGACCACCCTATCCAGTATATCCAGTGCGATATTTCCGCCGAGGAAGACGCCC
 
. : . : . : . : . : . :
JMSF005C11- AATCCAAGCTGTCTGTGCTGACAGATGTCACGCATGT
JMSF027F12- AATCCAAGCTGTCTGTGCTGACAGATGTCACGCATGTCTTCTACGTGACATGGGCCCACC
                      ____________________________________________________________
consensus AATCCAAGCTGTCTGTGCTGACAGATGTCACGCATGTCTTCTACGTGACATGGGCCCACC
 
. : . : . : . : . : . :
JMSF027F12- GACCCACGGAGCTGGAAAACTGTGAAGTCAACCGGAAAATGTTGGGGAACGTCCTAAACG
                      ____________________________________________________________
consensus GACCCACGGAGCTGGAAAACTGTGAAGTCAACCGGAAAATGTTGGGGAACGTCCTAAACG
 
. : . : . : . : . : . :
JMSF027F12- CCGTCGTCCCAAACTCTCCAGATCTGAAGCATATCTGCCTGCAAACCGGCCAAAAACACT
                      ____________________________________________________________
consensus CCGTCGTCCCAAACTCTCCAGATCTGAAGCATATCTGCCTGCAAACCGGCCAAAAACACT
 
. : . : . : . : . : . :
JMSF027F12- ACTGGGGCCCCTTCGAACTGTCCGGAAAACTCTCCCACGACCCGCCGCATCACGAGGATT
rJMSF027F12+ CGACCCGCCGCATCACGAGGATT
                      ____________________________________________________________
consensus ACTGGGGCCCCTTCGAACTGTCCGGAAAACTCTCCCACGACCCGCCGCATCACGAGGATT
 
. : . : . : . : . : . :
JMSF027F12- TGCCGCGACTCGACGCCCCCAACTTTTACTACGTTCTCGAGGATCTCCTGTTCGACGAGG
rJMSF027F12+ TGCCGCGACTCGACGCCCCCAACTTTTACTACGTTCTCGAGGATCTCCTGTTCGACGAGG
                      ____________________________________________________________
consensus TGCCGCGACTCGACGCCCCCAACTTTTACTACGTTCTCGAGGATCTCCTGTTCGACGAGG
 
. : . : . : . : . : . :
JMSF027F12- TTAAGAAGAAGAA
rJMSF027F12+ TTAAGAAGAAGAAGGAGGAGGGATTAACATTAACGTGGTCGGTTCACCGGCCGGGAACCA
                      ____________________________________________________________
consensus TTAAGAAGAAGAAGGAGGAGGGATTAACATTAACGTGGTCGGTTCACCGGCCGGGAACCA
 
. : . : . : . : . : . :
rJMSF027F12+ TCCACGGCTTCTCTCCGTACAGCATGATGAACATCGTGGGAACCCTCTGCGACTACGCCG
                      ____________________________________________________________
consensus TCCACGGCTTCTCTCCGTACAGCATGATGAACATCGTGGGAACCCTCTGCGACTACGCCG
 
. : . : . : . : . : . :
rJMSF027F12+ CTATCTGCAAGCACGAAGGCGCCCCGCTGAGATTCCCAGGGATTAAAGATTCCTGGGATG
                      ____________________________________________________________
consensus CTATCTGCAAGCACGAAGGCGCCCCGCTGAGATTCCCAGGGATTAAAGATTCCTGGGATG
 
. : . : . : . : . : . :
rJMSF027F12+ GGTACTCCATTTGCTCCGATGCGGATTTGATTGCGGAGCAAGAGATCTGGGCGGCGGTGG
                      ____________________________________________________________
consensus GGTACTCCATTTGCTCCGATGCGGATTTGATTGCGGAGCAAGAGATCTGGGCGGCGGTGG
 
. : . : . : . : . : . :
rJMSF005A09+ TCAACGTCAGCAATGGCGACGTCTTCAAATGGNAGC
rJMSF027F12+ ACCCATACGCCAAGAACGAAGCTTTCAACGTCAGCAATGGCGACGTCTTCAAATGGAAGC
                      ____________________________________________________________
consensus ACCCATACGCCAAGAACGAAGCTTTCAACGTCAGCAATGGCGACGTCTTCAAATGGAAGC
 
. : . : . : . : . : . :
rJMSF005A09+ ATTTGTGGAAGATCTTGGCGGANCAGTTTGAGGTGGAAGCTGGNGAATTCGAAGAGGAGG
rJMSF027F12+ ATTTGTGGAAGATCTTGGCGGAGCAGTTTGAGGTGGAAGCTGGGGAATTCGAAGAGGAGG
                      ____________________________________________________________
consensus ATTTGTGGAAGATCTTGGCGGAGCAGTTTGAGGTGGAAGCTGGGGAATTCGAAGAGGAGG
 
. : . : . : . : . : . :
rJMSF005A09+ GGGAGAGGCTTACTCTGCAGGAGATGATGAAGNAGAAAGGGCCTGTTTGGNATGCGATTG
rJMSF027F12+ GGGAGAGGCTTACTCTGCAGGAGATGATGAACGAGAAAGGGCCTGTTTGGGATGAGATTG
                      ____________________________________________________________
consensus GGGAGAGGCTTACTCTGCAGGAGATGATGAAGGAGAAAGGGCCTGTTTGGGATGCGATTG
 
. : . : . : . : . : . :
rJMSF005A09+ TGGAGAAAAACAACCTGCAACCTACGAAATTGGAGGATGTTGGAGTGTGGNGGTCTGCAG
rJMSF027F12+ TGGAGAAAAACAACCTGCAACCTACGAAATTGGAGGATGTTGGAGTGTGGTGGTTTGCAG
                      ____________________________________________________________
consensus TGGAGAAAAACAACCTGCAACCTACGAAATTGGAGGATGTTGGAGTGTGGTGGTTTGCAG
 
. : . : . : . : . : . :
rJMSF005A09+ ATGTTCTCTTAGGTATATGTTATCCTCTANACAGTATGAACAAGAGCAAAGAACATGGGT
rJMSF027F12+ ATGTTATCTTAGGTATATGTTATCCTCTAGACAGTATGAACAAGAGCAAAGAACATGGGT
                      ____________________________________________________________
consensus ATGTTCTCTTAGGTATATGTTATCCTCTAGACAGTATGAACAAGAGCAAAGAACATGGGT
 
. : . : . : . : . : . :
rJMSF005A09+ NTCTGGNGTTTAGNAACACCCACAAAGCCTTCATTTCATGGACTTGATGAGATGAANNGC
rJMSF027F12+ TTCTGGGGTTTAGGAACACCCACAAAGCCTTCATTTCATGGA-TTGATGAGATGAA-AGC
                      ____________________________________________________________
consensus TTCTGGGGTTTAGGAACACCCACAAAGCCTTCATTTCATGGACTTGATGAGATGAANAGC
 
. : . : . : . : . : . :
rJMSF005A09+ TCATAANATTGTTCCTTNAATTATNTTAGTCAAATTNTGTGCNTCGATCTATTCCAT
rJMSF027F12+ TCATAAGATTGTTCCTTAAATTATTTTAGTCAAATTTTGTGCTTCGATCTATTCCATCCT
                      ____________________________________________________________
consensus TCATAAGATTGTTCCTTAAATTATTTTAGTCAAATTTTGTGCTTCGATCTATTCCATCCT