Previous Contig 012539:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027F11Sequence626012539 (2)715012539 (2)gb:AP001366_18212004e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027F11- GGGAAATCTCCTCAAATTCTCTCTCTAGGTCCTTGG
                      ____________________________________________________________
consensus GGGAAATCTCCTCAAATTCTCTCTCTAGGTCCTTGG
 
. : . : . : . : . : . :
JMSF027F11- CCGAACAGCCATCATCCGCTGCTGTATAACCGCAACANCGCAGAACCNACCTCCCCAAAA
                      ____________________________________________________________
consensus CCGAACAGCCATCATCCGCTGCTGTATAACCGCAACANCGCAGAACCNACCTCCCCAAAA
 
. : . : . : . : . : . :
JMSF027F11- CCCCAAGATTTTGTAATCCTTTCGGCCGCTGATTTTCCTCAAAATTANTATTTTCTCACC
                      ____________________________________________________________
consensus CCCCAAGATTTTGTAATCCTTTCGGCCGCTGATTTTCCTCAAAATTANTATTTTCTCACC
 
. : . : . : . : . : . :
JMSF027F11- GCACATTTTGTATATTGTTTGCGTTTAATTTGTGTTCTGTGTAATCTATATATGAAATGG
                      ____________________________________________________________
consensus GCACATTTTGTATATTGTTTGCGTTTAATTTGTGTTCTGTGTAATCTATATATGAAATGG
 
. : . : . : . : . : . :
JMSF027F11- GAAAGAGAAAGAGGAAAGCTGACCTTAACAAGACCCCTCCTCCTCCAGACCTTATGCCAC
                      ____________________________________________________________
consensus GAAAGAGAAAGAGGAAAGCTGACCTTAACAAGACCCCTCCTCCTCCAGACCTTATGCCAC
 
. : . : . : . : . : . :
JMSF027F11- CACCACTTGGAATGGATTCAATAACAAAACAGAAGCTTTCGCATCAAAGTGAAGGCNGTG
                      ____________________________________________________________
consensus CACCACTTGGAATGGATTCAATAACAAAACAGAAGCTTTCGCATCAAAGTGAAGGCNGTG
 
. : . : . : . : . : . :
JMSF027F11- AAATAAAGCCGCCTTTCATGTCCATTATAGATACCACCGACAATTCTGTTAAGGTAACAA
                      ____________________________________________________________
consensus AAATAAAGCCGCCTTTCATGTCCATTATAGATACCACCGACAATTCTGTTAAGGTAACAA
 
. : . : . : . : . : . :
JMSF027F11- ANGGACATCAGCTATCTGNTGATCATCATCATCATCGCATATTAGCCGAGCTATATCATT
rJMSF027F11+ CATCAGCTATCTGCTGATCATCATCATCATCGCATATTAGNCGAGCTATATCANT
                      ____________________________________________________________
consensus ANGGACATCAGCTATCTGCTGATCATCATCATCATCGCATATTAGCCGAGCTATATCATT
 
. : . : . : . : . : . :
JMSF027F11- GAGGCATCATCGTCAATTTTATGGCCGCCATTATTCTCGACGGAANTCCACCAACAATGC
rJMSF027F11+ GAGGCATCATCGTCAATTTTATGGCCGCCATTATTCTCGACGGAACTCCACCAACAATGC
                      ____________________________________________________________
consensus GAGGCATCATCGTCAATTTTATGGCCGCCATTATTCTCGACGGAACTCCACCAACAATGC
 
. : . : . : . : . : . :
JMSF027F11- TGCTGCGGCATCAACTTCCCATGACAAGCTTTCTCCATCTTATGTTGACAAAACATCCTT
rJMSF027F11+ NGCTGCGGCATCAACTTCCCATGACAAGCTTTCTCCATCTTANGTTGACAAAACATCCTT
                      ____________________________________________________________
consensus TGCTGCGGCATCAACTTCCCATGACAAGCTTTCTCCATCTTATGTTGACAAAACATCCTT
 
. : . : . : . : . : . :
JMSF027F11- CAAGCTGGCTAGTAAATACCGTCCAGATTCTGGGTCAGGGGACCATTCAG
rJMSF027F11+ CAAGCTGGCTAGTAAATACCGTCCAGATTCTGGGTCAGGGGACCATTCAGATGCAGGGAA
                      ____________________________________________________________
consensus CAAGCTGGCTAGTAAATACCGTCCAGATTCTGGGTCAGGGGACCATTCAGATGCAGGGAA
 
. : . : . : . : . : . :
rJMSF027F11+ ACTGATATGCAGCTTATGCCAGAAGTTCATGAGGAAAAAACCCTGTATTCNTGAAACCGT
                      ____________________________________________________________
consensus ACTGATATGCAGCTTATGCCAGAAGTTCATGAGGAAAAAACCCTGTATTCNTGAAACCGT
 
. : . : . : . : . : . :
rJMSF027F11+ CGTACATTCCAGCGATCACTCGGTGGCAGCAGTTNTAAGTTGCGGTCACGTTTACCATNC
                      ____________________________________________________________
consensus CGTACATTCCAGCGATCACTCGGTGGCAGCAGTTNTAAGTTGCGGTCACGTTTACCATNC
 
. : . : . : . : . : . :
rJMSF027F11+ CGATTGCTTGGAGGAGAGGACGCCCCATGAAGATAGATGGGACCCACCCTGTCCCCAGTG
                      ____________________________________________________________
consensus CGATTGCTTGGAGGAGAGGACGCCCCATGAAGATAGATGGGACCCACCCTGTCCCCAGTG
 
. : . : . : . : . : . :
rJMSF027F11+ TTCACCATTACTATCAGGTNGATAGATTCTAGAGGGACGGACGGACAGGATTTAACTATA
                      ____________________________________________________________
consensus TTCACCATTACTATCAGGTNGATAGATTCTAGAGGGACGGACGGACAGGATTTAACTATA
 
. : . : . : . : . : . :
rJMSF027F11+ CAGGNTACCATTTCTCTGNCTGACATCGAAGATTAATAATCCAGTAGTAGGTATAGGTCC
                      ____________________________________________________________
consensus CAGGNTACCATTTCTCTGNCTGACATCGAAGATTAATAATCCAGTAGTAGGTATAGGTCC
 
. : . : . : . : . : . :
rJMSF027F11+ GTTAAGTTAGTTTTCGTNTAAGATAGAGTGGTCATGAACGTACTAACGCGACGTAGCCGA
                      ____________________________________________________________
consensus GTTAAGTTAGTTTTCGTNTAAGATAGAGTGGTCATGAACGTACTAACGCGACGTAGCCGA
 
. : . : . : . : . : . :
rJMSF027F11+ GGTAAATGTGTTTGTTTTTTACTGTGTTTTGCAAGTTGCTTAGGTGAAAATAACTTTGGA
                      ____________________________________________________________
consensus GGTAAATGTGTTTGTTTTTTACTGTGTTTTGCAAGTTGCTTAGGTGAAAATAACTTTGGA
 
. : . : . : . : . : . :
rJMSF027F11+ ATTGTTTGTTAGACTTTGTTGTGTGAATAGTTTGTGTTGCTTCCTTTAACTGCCTCAACA
                      ____________________________________________________________
consensus ATTGTTTGTTAGACTTTGTTGTGTGAATAGTTTGTGTTGCTTCCTTTAACTGCCTCAACA