Previous Contig 012528:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009K07Sequence400000509 (2)605012528 (2)gb:AB013396_15121778e-14Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTI20.>gb:BT014773_1641
JMSF027D09Sequence130000509 (2)698012528 (2)gb:AB013396_15121771e-13Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTI20.>gb:BT014773_1641

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009K07+ CCCCATAAGAATTGCAGATCA
rJMSF027D09+ ATCCACACATGCATACACCCCATAAGAATTGCAGATCA
                      ____________________________________________________________
consensus ATCCACACATGCATACACCCCATAAGAATTGCAGATCA
 
. : . : . : . : . : . :
rJMFF009K07+ GATAGCTAATTTTAGGTAAAATGCAGACCGTAAGTAGTTCAGTGAAAGAAGAATTTNTGA
rJMSF027D09+ GATAGCTAATTTTAGGTAAAATGCAGACCGTAAGTAGTTCAGTGAAAGAAGAATTTCTGA
                      ____________________________________________________________
consensus GATAGCTAATTTTAGGTAAAATGCAGACCGTAAGTAGTTCAGTGAAAGAAGAATTTCTGA
 
. : . : . : . : . : . :
rJMFF009K07+ AGAAATGGATAAAGGGTCTCCAAAAGTACGACGCCTGCAAGAGTGAAATGAGCATAACAG
rJMSF027D09+ AGAAATGGATAAAGGGTCTCCAAAAGTACGACGCCTGCAAGAGTGAAATGAGCATAACAG
                      ____________________________________________________________
consensus AGAAATGGATAAAGGGTCTCCAAAAGTACGACGCCTGCAAGAGTGAAATGAGCATAACAG
 
. : . : . : . : . : . :
rJMFF009K07+ AGAGGAAGAACGCCATAAAGCTATCAGCGAACGTAGCCATGGCCTCCACCACTACCAGCA
rJMSF027D09+ AGAGGAAGAACGCCATAAAGCTATCAGCGAACGTAGCCATGGCCTCCACCACTACCAGCN
                      ____________________________________________________________
consensus AGAGGAAGAACGCCATAAAGCTATCAGCGAACGTAGCCATGGCCTCCACCACTACCAGCA
 
. : . : . : . : . : . :
rJMFF009K07+ CCAGACAGTGGCCGCGAGCGATTTGGCGACGCTCAGTAATGGCGGCTGTGAAATNTGGGG
rJMSF027D09+ CCAGACAGTGGCCGCGAGCGATTTGGCGACGCTCAGTAATGGCGGCTGTGAAATNTGGGG
                      ____________________________________________________________
consensus CCAGACAGTGGCCGCGAGCGATTTGGCGACGCTCAGTAATGGCGGCTGTGAAATNTGGGG
 
. : . : . : . : . : . :
rJMFF009K07+ CCGGGGAGATGAAGAAAATCCGGCGCCGGAGATGTTTGATGAAGCGCATTNGTCGTCGTC
rJMSF027D09+ CCGGGGAGATGAAGAAAATCCGGCGCCGGAGATGTTTGATGAAGCGCNTTNGTNGTCGTC
                      ____________________________________________________________
consensus CCGGGGAGATGAAGAAAATCCGGCGCCGGAGATGTTTGATGAAGCGCATTNGTCGTCGTC
 
. : . : . : . : . : . :
rJMFF009K07+ GTCCAATGGCCGGAAAGCGTGCGGCTTCAAAGTATAAAGCGGCGGCGAGAGTGGTGAAGA
rJMSF027D09+ GTCCAATGGCCGGAAAGCGTGCGGCTTCAAAGTATAAAGCGGCGGCGAGAGTGGTGAAGA
                      ____________________________________________________________
consensus GTCCAATGGCCGGAAAGCGTGCGGCTTCAAAGTATAAAGCGGCGGCGAGAGTGGTGAAGA
 
. : . : . : . : . : . :
rJMFF009K07+ AGAGAAGCGCAGTTTTGAAAGGACTTATTCCGGGAGGAGAATGCATGGAAGATGATAACN
rJMSF027D09+ AGAGAAGCGCAGTTNTGAAAGGACTTATTCCGGGAGGAGAATGCATGGAAGATGATAACN
                      ____________________________________________________________
consensus AGAGAAGCGCAGTTTTGAAAGGACTTATTCCGGGAGGAGAATGCATGGAAGATGATAACN
 
. : . : . : . : . : . :
rJMFF009K07+ CTTTGATCAAAGAAACCCTAGATTACATACTCGCCCTGCGACTTCAAGTTGACGTCATGC
rJMSF027D09+ CTTTGATCAAAGAAACCCTAGATTACATACTCGCCCTGNGACTTCAAGTTGACGTCATGC
                      ____________________________________________________________
consensus CTTTGATCAAAGAAACCCTAGATTACATACTCGCCCTGCGACTTCAAGTTGACGTCATGC
 
. : . : . : . : . : . :
rJMFF009K07+ GCCNCCTTGCCTCCTNTACTACCTCCTCCTAGTACCTACGTTCGTTGTTGTTACTCACAT
rJMSF027D09+ GCCNCCTTGCCTCCTNTACTACCTCCTCCTAGTACCTACGTTCGTTGTTGTTACTCACAT
                      ____________________________________________________________
consensus GCCNCCTTGCCTCCTNTACTACCTCCTCCTAGTACCTACGTTCGTTGTTGTTACTCACAT
 
. : . : . : . : . : . :
rJMFF009K07+ AATGTTTTTCTTAAA-TTTTTTTTTTTCTTAATTTCTTTCC
rJMSF027D09+ AATGTTTTTNTTAAATTTTTTTTTTTTCTTAATTTCTTTCCATGTTCAGTTCAGTTCTTC
                      ____________________________________________________________
consensus AATGTTTTTCTTAAATTTTTTTTTTTTCTTAATTTCTTTCCATGTTCAGTTCAGTTCTTC
 
. : . : . : . : . : . :
rJMSF027D09+ CTTAATCCAATTCTGGACAGGTATGATATATATGATGCTACTCCATATATAGATCCATTA
                      ____________________________________________________________
consensus CTTAATCCAATTCTGGACAGGTATGATATATATGATGCTACTCCATATATAGATCCATTA