Previous Contig 012527:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027D08Sequence645006434 (3)pir|T04487|T044870.002hypothetical protein F8F16.10 - Arabidopsis thaliana>gb:ATCHRIV74_1547041 Arabid740012527 (3)gb:AP003766_18331964e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMSF031D10Sequence697006434 (3)pir|T04487|T044877e-15hypothetical protein F8F16.10 - Arabidopsis thaliana>gb:ATCHRIV74_1547041 Arabid779012527 (3)gb:AP003766_18331963e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000
JMSF048M22Sequence676006434 (3)pir|T04487|T044872e-09hypothetical protein F8F16.10 - Arabidopsis thaliana>gb:ATCHRIV74_1547041 Arabid701012527 (3)gb:AP003766_18331963e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031D10+ CCC
                      ____________________________________________________________
consensus CCC
 
. : . : . : . : . : . :
rJMSF031D10+ AAATTTACCAGATCAAGATAAACAAGTTCCTCATATTCCCTCCATGGCCCCCCAGCAGTT
rJMSF048M22+ CCCCAGCAGTT
rJMSF027D08+ CTCCATGGCCCCCCAGCAGTT
                      ____________________________________________________________
consensus AAATTTACCAGATCAAGATAAACAAGTTCCTCATATTCCCTCCATGGCCCCCCAGCAGTT
 
. : . : . : . : . : . :
rJMSF031D10+ TCACTCTACTTCAGTTCCTCATGCATTTCCCGGGACTTTGCCTGTGCCATCTTCAGTTCC
rJMSF048M22+ TCACTNTACTTCAGTTCCTCATGCATTTCCCGGGACTTTGCCTGTGCCATCTTCAGTTCC
rJMSF027D08+ TCACTCTACTTCAGTTCCTCATGCATTTCCCGGGACTTTGCCTGTGCCATCTTCAGTTCC
                      ____________________________________________________________
consensus TCACTCTACTTCAGTTCCTCATGCATTTCCCGGGACTTTGCCTGTGCCATCTTCAGTTCC
 
. : . : . : . : . : . :
rJMSF031D10+ ACCGTCAAATCTACCACCAACAACACATCTGATGCCAGCATTGACACCAAGTGCGGGTGA
rJMSF048M22+ ACCGTCAAATCTACCACCAACAACACATCTGATGCCAGCATTGACACCAAGTGCGGGTGA
rJMSF027D08+ ACCGTCAAATCTACCACCAACAACACATCTGATGCCAGCATTGACACCAAGTGCGGGTGA
                      ____________________________________________________________
consensus ACCGTCAAATCTACCACCAACAACACATCTGATGCCAGCATTGACACCAAGTGCGGGTGA
 
. : . : . : . : . : . :
rJMSF031D10+ AAAGTTGCCTCCGTATCCCTTGTTTCCACCTGGTCTTATTCCCGGGATGGTTAGAAAAAT
rJMSF048M22+ AAAGTTGCCTCCGTATCCCTTGTTTCCACCTGGTCTTATTCCCGGGATGGTTAGAAAAAT
rJMSF027D08+ AAAGTTGCCTCCGTATCCCTTGTTTCCACCTGGTCTTATTCCCGGGATGGTTAGAAAAAT
                      ____________________________________________________________
consensus AAAGTTGCCTCCGTATCCCTTGTTTCCACCTGGTCTTATTCCCGGGATGGTTAGAAAAAT
 
. : . : . : . : . : . :
rJMSF031D10+ GCAGATAGGCAGTGGGGTGCCTTACTCCCCCTTGAGCCCTTTGGATATCCCGACTGTTAT
rJMSF048M22+ GCAGATAGGCAGTGGGGTGCCTTACTCCCCCTTGAGCCCTTTGGATATCCCGACTGTTAT
rJMSF027D08+ GCAGATAGGCAGTGGGGTGCCTTACTCCCCCTTGAGCCCTTTGGATATCCCGACTGTTAT
                      ____________________________________________________________
consensus GCAGATAGGCAGTGGGGTGCCTTACTCCCCCTTGAGCCCTTTGGATATCCCGACTGTTAT
 
. : . : . : . : . : . :
rJMSF031D10+ ACCGCCCTCTACTGTTTCTCAATCCGAAATTCTTGAAAGAGTATCAAAATTC-TTAGGGA
rJMSF048M22+ ACCGCCCTCTACTGTTTCTCAATCCGAAATTCTTGAAAGAGTATCAAAATTCTTTAGGGA
rJMSF027D08+ ACCGCCCTCTACTGTTTCTCAATCCGAAATTCTTGAAAGAGTATCAAAATTCTTTAGGGA
                      ____________________________________________________________
consensus ACCGCCCTCTACTGTTTCTCAATCCGAAATTCTTGAAAGAGTATCAAAATTCTTTAGGGA
 
. : . : . : . : . : . :
rJMSF031D10+ GATTGGTGAGGTTAACCCATCAGAAGGACCCATGAAACAAGCTGATTCACCCGATGAATA
rJMSF048M22+ GATTGGTGAGGTTAACCCATCAGAAGGACCCATGAAACAAGCTGATTCACCCGATGAATA
rJMSF027D08+ GATTGGTGAGGTTAACCCATCAGAAGGACCCATGAAACAAGCTGATTCACCCGATGAATA
                      ____________________________________________________________
consensus GATTGGTGAGGTTAACCCATCAGAAGGACCCATGAAACAAGCTGATTCACCCGATGAATA
 
. : . : . : . : . : . :
rJMSF031D10+ TGACGATTATGAGAGAGAGCGAGAGCCTCCCATCCGAAAAGGCGGGGCTTGCATCCCTCC
rJMSF048M22+ TGACGATTATGAGAGAGAGCGAGAGCCTCACATCCGAAAAGGCGGGGCTTGCATCCCTCC
rJMSF027D08+ TGACGATTATGAGAGAGAGCGAGAGCCTCCCATCCGAAAAGGCGGGGCTTGCATCCCTCC
                      ____________________________________________________________
consensus TGACGATTATGAGAGAGAGCGAGAGCCTCCCATCCGAAAAGGCGGGGCTTGCATCCCTCC
 
. : . : . : . : . : . :
rJMSF031D10+ CCCACCTAACCTCCAGGATTCTGATGGAAGTGCAGATCCTGAACCAAAAAGCTCAGGACG
rJMSF048M22+ CCCACCTAACCTCCAGGATTCTGATGGAAGTGCAGATCCTGAACCAAAAAGCTCAGGACG
rJMSF027D08+ CCCACCTAACCTCCAGGATTCTGATGGAAGTGCAGATCCTGAACCAAAAAGCTCAGGACG
                      ____________________________________________________________
consensus CCCACCTAACCTCCAGGATTCTGATGGAAGTGCAGATCCTGAACCAAAAAGCTCAGGACG
 
. : . : . : . : . : . :
rJMSF031D10+ ACTGGGACTCGGTGCCAGCGCCAATCCAAATGAGGCCAGTCAATATGACGATGTTTACAG
rJMSF048M22+ ACTGGGACTCGGTGCCAGCGCCAATCCAAATGAGGCCAGTCAATATGACGATGTTTACAG
rJMSF027D08+ ACTGGGACTCGGTGCCAGCGCCAATCCAAATGAGGCCAGTCAATATGACGATGTTTACAG
                      ____________________________________________________________
consensus ACTGGGACTCGGTGCCAGCGCCAATCCAAATGAGGCCAGTCAATATGACGATGTTTACAG
 
. : . : . : . : . : . :
rJMSF031D10+ TTCTTACCGGAAACAAAGAAGCACCAATTATCATTCAACAATGAGTGCAAGAGCTCCTTC
rJMSF048M22+ TTCTTACCGGAAACAAAGAAGCACCAATTATCATTCAACAATGAGTGCAAGAGCTCCTTC
rJMSF027D08+ TTCTTACCGGAAACAAAGAAGCACCAATTATCATTCAACAATGAGTGCAAGAGCTCCTTC
                      ____________________________________________________________
consensus TTCTTACCGGAAACAAAGAAGCACCAATTATCATTCAACAATGAGTGCAAGAGCTCCTTC
 
. : . : . : . : . : . :
rJMSF031D10+ AACTAGGTAGTGAGATGTGTTAACAACTTGAGTTTTGCAGTTATATAGTCCCTAAGAGAG
rJMSF048M22+ AACTAGGTAGTGAGATGTGTTAACAACTTGAGTTTTGCAGTTATATAGTCCCTAAGAGAG
rJMSF027D08+ AACTAGGTAGTGAGATGTGTTAACAACTTGAGTTTTGCAGTTATATAGTCCCTAAGAGAG
                      ____________________________________________________________
consensus AACTAGGTAGTGAGATGTGTTAACAACTTGAGTTTTGCAGTTATATAGTCCCTAAGAGAG
 
. : . : . : . : . : . :
rJMSF031D10+ ACAAAAAA-CATGTGATTAAAACAAAATTTTCTTTTTATTTGTACTCTGGTGTTAAC
rJMSF048M22+ ACAAAAAACCATGTGATTAAAACAAAATTT
rJMSF027D08+ ACAAAAAA-CATGTGATTAAAACAAAATTTTCTTTTTATTTGTACTCTGGTGTTAACNTT
                      ____________________________________________________________
consensus ACAAAAAA-CATGTGATTAAAACAAAATTTTCTTTTTATTTGTACTCTGGTGTTAACNTT