Previous Contig 012526:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017F10Sequence245005678 (2)pir|T02324|T023249e-05hypothetical protein At2g34360 [imported] - Arabidopsis thaliana>gb:AC004481_153778012526 (2)gb:AP006048_18604605e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B142
JMSF027D05Sequence601005678 (2)pir|T02324|T023246e-51hypothetical protein At2g34360 [imported] - Arabidopsis thaliana>gb:AC004481_153730012526 (2)gb:AP006048_18604606e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B142

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017F10+ TAATGACGTTTCTGAAACTGGCCATCCCTTCAGCCGCTATGCTTTGC
                      ____________________________________________________________
consensus TAATGACGTTTCTGAAACTGGCCATCCCTTCAGCCGCTATGCTTTGC
 
. : . : . : . : . : . :
rJMSF017F10+ TTGGAGTATTGGTCATTTGAGGTAATGGTTTTGTTAGCCGGCATTCTTCCAAATCCAGAA
rJMSF027D05+ AAATCCAGAA
                      ____________________________________________________________
consensus TTGGAGTATTGGTCATTTGAGGTAATGGTTTTGTTAGCCGGCATTCTTCCAAATCCAGAA
 
. : . : . : . : . : . :
rJMSF017F10+ CTTGAAGCATCTGCTGTTTCTATCACCCTTAATACATGTGCCATAGTGTATATGCTCCCT
rJMSF027D05+ CTTGAAGCATCTGCTGTTTCTATCACCCTTAATACATGTGCCATAGTGTATATGCTCCCT
                      ____________________________________________________________
consensus CTTGAAGCATCTGCTGTTTCTATCACCCTTAATACATGTGCCATAGTGTATATGCTCCCT
 
. : . : . : . : . : . :
rJMSF017F10+ TTTGGCATTAGTGGCGCCCTAAGCATTAGAGTTTCAAACGAACTGGGAGGAGGAGACCCA
rJMSF027D05+ TTTGGCATTAGTGGCGCCCTAAGCATTAGAGTTTCAAACGAACTGGGAGGAGGAGACCCA
                      ____________________________________________________________
consensus TTTGGCATTAGTGGCGCCCTAAGCATTAGAGTTTCAAACGAACTGGGAGGAGGAGACCCA
 
. : . : . : . : . : . :
rJMSF017F10+ GTGGCAGCCCGAAGAGCAGTATCAACCGGAATACTTGTGGTTATTGCAGAAGGGATTGTG
rJMSF027D05+ GTGGCAGCCCGAAGAGCAGTATCAACCGGAATACTTGTGGTTATTGCAGAAGGGATTGTG
                      ____________________________________________________________
consensus GTGGCAGCCCGAAGAGCAGTATCAACCGGAATACTTGTGGTTATTGCAGAAGGGATTGTG
 
. : . : . : . : . : . :
rJMSF017F10+ GCAGCAACCCTAATGGTTTCAGTGCATAAAGTTTGGGGCTATTGTTACAGCACTGAGGAA
rJMSF027D05+ GCAGCAACCCTAATGGTTTCAGTGCATAAAGTTTGGGGCTATTGTTACAGCACTGAGGAA
                      ____________________________________________________________
consensus GCAGCAACCCTAATGGTTTCAGTGCATAAAGTTTGGGGCTATTGTTACAGCACTGAGGAA
 
. : . : . : . : . : . :
rJMSF017F10+ GAAGTAGTGACATATGTTGGGCAGATGCTACTGTTGTTAGCAGGGTCGCATTTCTTGGAT
rJMSF027D05+ GAAGTAGTGACATATGTTGGGCAGATGCTACTGTTGTTAGCAGGGTCGCATTTCTTGGAT
                      ____________________________________________________________
consensus GAAGTAGTGACATATGTTGGGCAGATGCTACTGTTGTTAGCAGGGTCGCATTTCTTGGAT
 
. : . : . : . : . : . :
rJMSF017F10+ GGCATTCAATGTGTGCTCTCAGGTGCTGCAAGAGGGTGTGGATGGCAACACATTGGGGCA
rJMSF027D05+ GGCATTCAATGTGTGCTCTCAGGTGCTGCAAGAGGGTGTGGATGGCAACACATTGGGGCA
                      ____________________________________________________________
consensus GGCATTCAATGTGTGCTCTCAGGTGCTGCAAGAGGGTGTGGATGGCAACACATTGGGGCA
 
. : . : . : . : . : . :
rJMSF017F10+ ATCATCAATCTTGGAGCATATTATCTGGTTGGATTGCCTGCTGCTATATTCTTAGCATTT
rJMSF027D05+ ATCATCAATCTTGGAGCATATTATCTGGTTGGATTGCCTGCTGCTATATTCTTAGCATTT
                      ____________________________________________________________
consensus ATCATCAATCTTGGAGCATATTATCTGGTTGGATTGCCTGCTGCTATATTCTTAGCATTT
 
. : . : . : . : . : . :
rJMSF017F10+ GTTCTCCATGTTGGAGGGAAGGGACTTTGGTTGGGAACCATGGTGGCTCTTTTTGTGCAA
rJMSF027D05+ GTTCTCCATGTTGGAGGGAAGGGACTTTGGTTGGGAACCATGGTGGCTCTTTTTGTGCAA
                      ____________________________________________________________
consensus GTTCTCCATGTTGGAGGGAAGGGACTTTGGTTGGGAACCATGGTGGCTCTTTTTGTGCAA
 
. : . : . : . : . : . :
rJMSF017F10+ GCAATACTTCTTGGTATAGTAACCTGGAGAACAAATTGGGAGAAAGAGGCAATGAAGGCA
rJMSF027D05+ GCAATACTTCTTGGTATAGTAACCTGGAGAACAAATTGGGAGAAAGAGGCAATGAAGGCA
                      ____________________________________________________________
consensus GCAATACTTCTTGGTATAGTAACCTGGAGAACAAATTGGGAGAAAGAGGCAATGAAGGCA
 
. : . : . : . : . : . :
rJMSF017F10+ GCTAATAGAGTGGGGGACAGCATGATCCCACATTAGTATTCACAAGTTAAAATGGAAACA
rJMSF027D05+ GCTAATAGAGTGGGGGACAGCATGATCCCACATTAGTATTCACAAGTTAAAATGGAAACA
                      ____________________________________________________________
consensus GCTAATAGAGTGGGGGACAGCATGATCCCACATTAGTATTCACAAGTTAAAATGGAAACA
 
. : . : . : . : . : . :
rJMSF017F10+ AAATTTCGGATCCATCCTAAGTTTATTCCAAAGTAATGTTGTTGGCAATTTTGAACAGTT
rJMSF027D05+ AAATTTCGGATCCATCCTAAGTTTATTCCAAAGTAATGTTGTTGGCAATTTTGAACAGTT
                      ____________________________________________________________
consensus AAATTTCGGATCCATCCTAAGTTTATTCCAAAGTAATGTTGTTGGCAATTTTGAACAGTT
 
. : . : . : . : . : . :
rJMSF027D05+ TGTTTGTGTTGCAAGTAACAGTACTGAATCTAAAGAGGATGCATGCATTCTTGGAGATAT
                      ____________________________________________________________
consensus TGTTTGTGTTGCAAGTAACAGTACTGAATCTAAAGAGGATGCATGCATTCTTGGAGATAT