Previous Contig 012521:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003B14Sequence472012521 (18)gb:AF325024_17864783e-30Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.790008256 (3)gb:AB017071_15135097e-63Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMFF023D11Sequence524012521 (18)gb:AF325024_17864781e-39Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.751012521 (18)gb:AB017071_15135091e-76Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMFF043F15Sequence642012521 (18)gb:AB017071_15135098e-60Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155655012521 (18)gb:AB017071_15135091e-54Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMFS042E09Sequence631012521 (18)gb:AF325024_17864788e-54Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.
JMSF020C22Sequence697012521 (18)gb:AB017071_15135093e-62Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155722012521 (18)gb:AB017071_15135091e-76Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF027B20Sequence675008256 (3)gb:AF325024_17864781e-45Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.643012521 (18)gb:AB017071_15135095e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF030O08Sequence634012521 (18)gb:AB017071_15135096e-56Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155755012521 (18)gb:AB017071_15135093e-77Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF041E21Sequence769020096gb:AF325024_17864785e-37Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.671012521 (18)gb:AB017071_15135091e-24Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF041P13Sequence635012521 (18)gb:AB017071_15135096e-56Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155620012521 (18)gb:AB017071_15135094e-54Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF043I10Sequence660012521 (18)gb:AB017071_15135095e-63Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155720012521 (18)gb:AB017071_15135093e-68Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155
JMSF051P22Sequence652012521 (18)gb:AF325024_17864783e-55Arabidopsis thaliana AT3g15840 (AT3g15840/MSJ11_24) mRNA, complete cds.702012521 (18)gb:AB017071_15135092e-74Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:AY035025_155

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051P22- GTGGTTGTGTTTTTATATCTCCTCATCTTCCTTATCT
JMFS042E09- ATATCTCCTCATCTTCCTTATCT
JMSF020C22- GGTGTGGTTGTGTTTTTATATCTCCTCATCTTCCTTATCT
                      ____________________________________________________________
consensus GGTGTGGTTGTGTTTTTATATCTCCTCATCTTCCTTATCT
 
. : . : . : . : . : . :
JMSF051P22- CATACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMFF003B14- TGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMFS042E09- CATACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMFF043F15- ACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMFF023D11- ACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMSF020C22- CATACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMSF030O08- GAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMSF041P13- GAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
JMSF043I10- CACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
                      ____________________________________________________________
consensus CATACACTGAACTGCAATCACTAAACACTTGACTGCAAAATGGCTGCTGCAGCTGCAACG
 
. : . : . : . : . : . :
JMSF051P22- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMFF003B14- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMFS042E09- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMFF043F15- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMFF023D11- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMSF020C22- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMSF030O08- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMSF041P13- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
JMSF043I10- ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
                      ____________________________________________________________
consensus ACTGCATCCATATTGTCTGCAACCCGGTCTGCTTCGACTAGTGCTGAAACTCCCTCTGCA
 
. : . : . : . : . : . :
JMSF051P22- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMFF003B14- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMFS042E09- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMFF043F15- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMFF023D11- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMSF020C22- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMSF030O08- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMSF041P13- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
JMSF043I10- TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
                      ____________________________________________________________
consensus TCTAACAGATATACTACAAGTTTTAGGGGAAATTCATCGAGAAGATATGATTCGATTAAG
 
. : . : . : . : . : . :
JMSF051P22- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMFF003B14- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMFS042E09- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMFF043F15- AGGAGG-TAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMFF023D11- AGGAGG-TAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMSF020C22- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMSF030O08- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMSF041P13- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
JMSF043I10- AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
                      ____________________________________________________________
consensus AGGAGGTTAATTAAGAGTAATGGACGAATCAATGCTGCTGCTACTGTTGCAACTGCTTCT
 
. : . : . : . : . : . :
JMSF051P22- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMFF003B14- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMFS042E09- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMFF043F15- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMFF023D11- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMSF020C22- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMSF030O08- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMSF041P13- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
JMSF043I10- GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
                      ____________________________________________________________
consensus GTCGAAGAAGTTAAAGAATACGCCCTCCCTACATGGGCTAAATTTGACCTGGGCCGAGCT
 
. : . : . : . : . : . :
JMSF051P22- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMFF003B14- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMFS042E09- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMFF043F15- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMFF023D11- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMSF020C22- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
JMSF030O08- CCAGTTTACTGGAAAACAATGAATG-----------------GGAGAGACGTTGCGGCTT
JMSF041P13- CCAGTTTACTGGAAAACAATGAATG-----------------GGAGAGACGTTGCGGCTT
JMSF043I10- CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
rJMSF020C22+ GAGAGACGTTGCGGCTT
rJMSF030O08+ GGAGAGACGGTGCGGCTT
rJMFF023D11+ AGAGACGTTGCGGCTT
                      ____________________________________________________________
consensus CCAGTTTACTGGAAAACAATGAATGGTCTTCTTCCCACTTCTGGAGAGACGTTGCGGCTT
 
. : . : . : . : . : . :
JMSF051P22- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMFF003B14- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMFS042E09- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMFF043F15- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMFF023D11- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMSF020C22- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMSF030O08- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMSF041P13- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
JMSF043I10- TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
rJMSF020C22+ TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
rJMSF030O08+ TTNTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
rJMSF051P22+ TATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
rJMSF043I10+ AAGCTTACCCCCAATGAAGAATTTTGGGAATTGCCTTCA
rJMFF023D11+ TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
                      ____________________________________________________________
consensus TTCTATAATCCATCTGCCAACAAGCTTACCCCCAATGAAGAATTT--GGAATTGCCTTCA
 
. : . : . : . : . : . :
JMSF051P22- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMFF003B14- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGA
JMFS042E09- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMFF043F15- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMFF023D11- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMSF020C22- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMSF030O08- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMSF041P13- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
JMSF043I10- ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMSF020C22+ ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMSF030O08+ ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMSF051P22+ ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMSF043I10+ ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMSF041P13+ GGGTCATGCTTCAGAAAA
rJMFF023D11+ ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
rJMFF043F15+ AAAA
                      ____________________________________________________________
consensus ATGGAGGATTCAATCAGCCTATCATGTGTGGTGGTGAGCCGAGGGTCATGCTTCAGAAAA
 
. : . : . : . : . : . :
JMSF051P22- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMFS042E09- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMFF043F15- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMFF023D11- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCT
JMSF020C22- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMSF030O08- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMSF041P13- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
JMSF043I10- CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMSF020C22+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMSF030O08+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMSF051P22+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMSF043I10+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMSF041P13+ CGCGAGGGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMFF023D11+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
rJMFF043F15+ CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
                      ____________________________________________________________
consensus CGCGA-GGAAAAGCTGATCCTCCTATATATACAATTCAGATATGTATTCCTAAACACGCC
 
. : . : . : . : . : . :
JMSF051P22- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMFS042E09- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMFF043F15- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMSF020C22- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMSF030O08- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMSF041P13- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
JMSF043I10- CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF020C22+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF030O08+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF051P22+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF043I10+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF041P13+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMFF023D11+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMFF043F15+ CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
rJMSF027B20+ CATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
                      ____________________________________________________________
consensus CATAGTTTGATCTTTTCATTCACAAATGGAACTGAATGGGATGGTCCCTATAGACTCCAA
 
. : . : . : . : . : . :
JMSF051P22- TTTCAAGTTCCAAAGCC
JMFS042E09- TTTCAAGTTCC
JMFF043F15- TTTCAAGTTCNCAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAG
JMSF020C22- TTTCAAGTTCCAAAGCCTTGGCGAANCAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
JMSF030O08- TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
JMSF041P13- TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
JMSF043I10- TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF020C22+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF030O08+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF051P22+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF043I10+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF041P13+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMFF023D11+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMFF043F15+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
rJMSF041E21+ AGGGCCTTGCG
rJMSF027B20+ TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
                      ____________________________________________________________
consensus TTTCAAGTTCCAAAGCCTTGGCGAAACAAGCCAATTGAATTCTTTACAGAGGGCCTTGCG
 
. : . : . : . : . : . :
JMSF030O08- G
JMSF041P13- GA
JMSF043I10- GAGGA
rJMSF020C22+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF030O08+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF051P22+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF043I10+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF041P13+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMFF023D11+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMFF043F15+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF041E21+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
rJMSF027B20+ GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
                      ____________________________________________________________
consensus GAGGAGTTGAGTAAGGAAGGTGCATGTGACAGAGCAATCTTTCCCGACGCAAACACAGTT
 
. : . : . : . : . : . :
rJMSF020C22+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF030O08+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF051P22+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF043I10+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF041P13+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMFF023D11+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMFF043F15+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF041E21+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
rJMSF027B20+ ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
                      ____________________________________________________________
consensus ATCACGACTTGTGCTGTGGTTGGTAACTTGACTATTGAAGGCGGTGATCGTTGCAATCTC
 
. : . : . : . : . : . :
rJMSF020C22+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF030O08+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF051P22+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF043I10+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF041P13+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMFF023D11+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMFF043F15+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF041E21+ AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
rJMSF027B20+ AATTTGATGCCCGGATTCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
                      ____________________________________________________________
consensus AATTTGATGCCCGGATGCACCGACCCAAGCTCACCATTATACGATCCACTCGCGAACGTT
 
. : . : . : . : . : . :
rJMSF020C22+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF030O08+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF051P22+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF043I10+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF041P13+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMFF023D11+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMFF043F15+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF041E21+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
rJMSF027B20+ GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
                      ____________________________________________________________
consensus GATGATGGATCATGCCCACCCTACTCAGACTCCGAGGATTAGATTCAAACATAAGCATTT
 
. : . : . : . : . : . :
rJMSF020C22+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF030O08+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF051P22+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF043I10+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF041P13+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMFF023D11+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMFF043F15+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF041E21+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
rJMSF027B20+ CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
                      ____________________________________________________________
consensus CATTCCATATATGATCAGAATTACGCTTTACAGTTCATGCAGTAACCAAACAAAGATGGC
 
. : . : . : . : . : . :
rJMSF020C22+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF030O08+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF051P22+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF043I10+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF041P13+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMFF023D11+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMFF043F15+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF041E21+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
rJMSF027B20+ TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
                      ____________________________________________________________
consensus TGTAAGTATCTTTGGCACCTGATATCCAGCTTCATACGAGTTTATAATGTACAAAATGTC
 
. : . : . : . : . : . :
rJMSF020C22+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGAT
rJMSF030O08+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT
rJMSF051P22+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGAT
rJMSF043I10+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGTAAAACACGG
rJMSF041P13+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AA
rJMFF023D11+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AAACACGG
rJMFF043F15+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AAACACGG
rJMSF041E21+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AAACACGG
rJMSF027B20+ AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AAACACGG
                      ____________________________________________________________
consensus AAATATGTTTTACTTGAAGAATGCATTAGGCTGTACATCTTTTGCGATGGT-AAACACGG
 
. : . : . : . : . : . :
rJMSF043I10+ ATTGTTTATATATA
rJMFF023D11+ ATTGTTTATATATACGCAG
rJMFF043F15+ ATTGTTTATATATACGCAGTATATAAATTGTTATGCAA
rJMSF041E21+ ATTGTTTATATATACGCAGTATATAAATTGTTATGCAATACAGAGTAGTTGTGAGTTGGT
rJMSF027B20+ ATTGTTTATATATACGCAGTATATAAATTGTTATGCAATACAGAGTAGTTGTGAGTTGGT
                      ____________________________________________________________
consensus ATTGTTTATATATACGCAGTATATAAATTGTTATGCAATACAGAGTAGTTGTGAGTTGGT
 
. : . : . : . : . : . :
rJMSF041E21+ GCAACCAATCAAGGTTGGTCTGACTTGTGCTTGGGGTTTAAGAAATCGCACTATACGTGC
rJMSF027B20+ GCAACCAATCAAGGTTGGTCTGACTTGTGCTTGGGGTTTAAGAAATCGCACTATACGTGC
                      ____________________________________________________________
consensus GCAACCAATCAAGGTTGGTCTGACTTGTGCTTGGGGTTTAAGAAATCGCACTATACGTGC