Previous Contig 012517:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027A21Sequence673006427 (2)gb:AK118468_18164452e-12Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA422012517 (2)
JMSF049M09Sequence682020503364012517 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027A21+ AN
                      ____________________________________________________________
consensus AN
 
. : . : . : . : . : . :
rJMSF049M09+ GGGGNTTTTTTTTTTTTGAAGTTTTATGCA
rJMSF027A21+ GGTTNNCCNGGGNNAAANGNGNAATGGNTGGGGGNTTTTTTTTTTTTGAAGTTTTATGCA
                      ____________________________________________________________
consensus GGTTNNCCNGGGNNAAANGNGNAATGGNTGGGGGNTTTTTTTTTTTTGAAGTTTTATGCA
 
. : . : . : . : . : . :
rJMSF049M09+ GAAATCTCTAGATCTATACTTTGGGAGGAACTTCAAAGTGCAGCTAAAGTGCTTAAAATG
rJMSF027A21+ GAAATCTCTAGATCTATACTTTGGGAGGAACTTCAAAGTGCAGCTAAAGTGCTTAAAATG
                      ____________________________________________________________
consensus GAAATCTCTAGATCTATACTTTGGGAGGAACTTCAAAGTGCAGCTAAAGTGCTTAAAATG
 
. : . : . : . : . : . :
rJMSF049M09+ CTTCACACTTTTAAGCTTAGATCATTCAATGGGTCAAGGTTTGAATTGCAATTCATCGAG
rJMSF027A21+ CTTCACACTTTTAAGCTTAGATCATTCAATGGGTCAAGGTTTGAATTGCAATTCATCGAG
                      ____________________________________________________________
consensus CTTCACACTTTTAAGCTTAGATCATTCAATGGGTCAAGGTTTGAATTGCAATTCATCGAG
 
. : . : . : . : . : . :
rJMSF049M09+ GTGCTACTTGCTTGCTTTCCCGCACTTGAAAAGGTTGTCATTATTCGCCAGATGGAGTTT
rJMSF027A21+ GTGCTACTTGCTTGCTTTCCCGCACTTGAAAAGGTTGTCATTATTCGCCAGATGGAGTTT
                      ____________________________________________________________
consensus GTGCTACTTGCTTGCTTTCCCGCACTTGAAAAGGTTGTCATTATTCGCCAGATGGAGTTT
 
. : . : . : . : . : . :
rJMSF049M09+ GATTCCAATGAGGAGTTTAAAATCATGCAAAAGTTTTTTCATTTTCTCCTCGTGCATCAA
rJMSF027A21+ GATTCCAATGAGGAGTTTAAAATCATGCAAAAGTTTTTTCATTTTCTCCTCGTGCATCAA
                      ____________________________________________________________
consensus GATTCCAATGAGGAGTTTAAAATCATGCAAAAGTTTTTTCATTTTCTCCTCGTGCATCAA
 
. : . : . : . : . : . :
rJMSF049M09+ AGAAAGCAAAAATTGTTTACATATAAGCATCTTATTATATTTTTGTTGAATTAATATATG
rJMSF027A21+ AGAAAGCAAAAATTGTTTACATATAAGCATCTTATTATATTTTTGTTGAATTAATATATG
                      ____________________________________________________________
consensus AGAAAGCAAAAATTGTTTACATATAAGCATCTTATTATATTTTTGTTGAATTAATATATG
 
. : . : . : . : . : . :
rJMSF049M09+ CATCTCCTTGATTCACTCTTTGAGTTCAATATTT
rJMSF027A21+ CATCTCCTTGATTCACTCTTTGAGTTCAATATTTTGTAATGTACCTAATGGTAACCTCGA
                      ____________________________________________________________
consensus CATCTCCTTGATTCACTCTTTGAGTTCAATATTTTGTAATGTACCTAATGGTAACCTCGA