Previous Contig 012511:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026P21Sequence658012511 (2)gb:AY063929_15658762e-26Arabidopsis thaliana unknown protein (At5g08340) mRNA, complete cds.>gb:AY091253717012511 (2)gb:AY063929_15658764e-72Arabidopsis thaliana unknown protein (At5g08340) mRNA, complete cds.>gb:AY091253

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026P21- GGGATTATCACTCTCCCTCCCAAGAG
                      ____________________________________________________________
consensus GGGATTATCACTCTCCCTCCCAAGAG
 
. : . : . : . : . : . :
JMSF026P21- TCTTGCGTAGCTACTGCGAACCAGAGGACCAGACTGACGTGCCGTGCGGCGGACCGGCGA
                      ____________________________________________________________
consensus TCTTGCGTAGCTACTGCGAACCAGAGGACCAGACTGACGTGCCGTGCGGCGGACCGGCGA
 
. : . : . : . : . : . :
JMSF026P21- TGGAGTGAGGACGTGCGGCTGACCAGCAGTGGCGTGAGGTCTCGATTGGAAGTAGATTTA
                      ____________________________________________________________
consensus TGGAGTGAGGACGTGCGGCTGACCAGCAGTGGCGTGAGGTCTCGATTGGAAGTAGATTTA
 
. : . : . : . : . : . :
JMSF026P21- TTTTTCTTGGAGAAGTGTTGGAACCATAGTTGTTTATTTTGGGCCCTTTGGAATTGTATG
                      ____________________________________________________________
consensus TTTTTCTTGGAGAAGTGTTGGAACCATAGTTGTTTATTTTGGGCCCTTTGGAATTGTATG
 
. : . : . : . : . : . :
JMSF026P21- AAAGTAGATCTGGTAAGTTATCATGGGTTCCTTATCTGGAATCCTTCTAAGGCCGGTACT
                      ____________________________________________________________
consensus AAAGTAGATCTGGTAAGTTATCATGGGTTCCTTATCTGGAATCCTTCTAAGGCCGGTACT
 
. : . : . : . : . : . :
JMSF026P21- TGTCTGGAATCCATCATTGCTCCACTGCAGAAATAGGACTCCTTCCAGTAGTGGTTGCAC
                      ____________________________________________________________
consensus TGTCTGGAATCCATCATTGCTCCACTGCAGAAATAGGACTCCTTCCAGTAGTGGTTGCAC
 
. : . : . : . : . : . :
JMSF026P21- TAATAAAGTTAATGACTTGGGAGTTTCTTTCTACAATTGTGTGCATCCGAAATCTGTACA
                      ____________________________________________________________
consensus TAATAAAGTTAATGACTTGGGAGTTTCTTTCTACAATTGTGTGCATCCGAAATCTGTACA
 
. : . : . : . : . : . :
JMSF026P21- TACCCAAAGCTCCTTGCTTTCTGATTCTTTAAGTCGATCTGAAGATGGTGAGGAGCCTCC
                      ____________________________________________________________
consensus TACCCAAAGCTCCTTGCTTTCTGATTCTTTAAGTCGATCTGAAGATGGTGAGGAGCCTCC
 
. : . : . : . : . : . :
JMSF026P21- ACAAGAACGATTACCCTTTGTTGCAGGTGGGATAGTAGCTTTGGGTAAATTTGAGGCGCT
                      ____________________________________________________________
consensus ACAAGAACGATTACCCTTTGTTGCAGGTGGGATAGTAGCTTTGGGTAAATTTGAGGCGCT
 
. : . : . : . : . : . :
JMSF026P21- TCACATTGGCCACAGGGAACTTGCAATCCAGGCAGCAAAGATAGGAGTTCCATTTCTACT
                      ____________________________________________________________
consensus TCACATTGGCCACAGGGAACTTGCAATCCAGGCAGCAAAGATAGGAGTTCCATTTCTACT
 
. : . : . : . : . : . :
JMSF026P21- CTCATTTGTTGGAATGGCTGAAGTACTCGGTTGGGAACTTAGGGTTCCCATTGTTGCCAA
rJMSF026P21+ ATTTGTTGGAATGGCTGAAGTACTCGGTTGGGAACTTAGGGTTCCCATTGTTGCCAA
                      ____________________________________________________________
consensus CTCATTTGTTGGAATGGCTGAAGTACTCGGTTGGGAACTTAGGGTTCCCATTGTTGCCAA
 
. : . : . : . : . : . :
JMSF026P21- ATGTGACCGCAAAAGAGTTCTCTCCTCTTGGG
rJMSF026P21+ ATGTGACCGCAAAAGAGTTCTCTCCTCTTGGGCTCCCTATTGTGGTGGAATGATCCCCAG
                      ____________________________________________________________
consensus ATGTGACCGCAAAAGAGTTCTCTCCTCTTGGGCTCCCTATTGTGGTGGAATGATCCCCAG
 
. : . : . : . : . : . :
rJMSF026P21+ AGAATTCCAAATAGAATTTTCAAAAGTTCGATACCTCACCCCTCGTGATTTTGTTGAGAA
                      ____________________________________________________________
consensus AGAATTCCAAATAGAATTTTCAAAAGTTCGATACCTCACCCCTCGTGATTTTGTTGAGAA
 
. : . : . : . : . : . :
rJMSF026P21+ GCTGTCGAAAGACCTTGGGGTACTTGGTGTGGTGGCAGGTGAAAACTACCGGTTTGGGTA
                      ____________________________________________________________
consensus GCTGTCGAAAGACCTTGGGGTACTTGGTGTGGTGGCAGGTGAAAACTACCGGTTTGGGTA
 
. : . : . : . : . : . :
rJMSF026P21+ CAAGGCTTCCGGGGATGCATCAGACCTGTTGAGGCTTTGTAATGAATACGGCATTCAGGC
                      ____________________________________________________________
consensus CAAGGCTTCCGGGGATGCATCAGACCTGTTGAGGCTTTGTAATGAATACGGCATTCAGGC
 
. : . : . : . : . : . :
rJMSF026P21+ TTGTATAATTAATTCCGTCATGGACAAGAATCAAGATCCTAGCAGCTTATATTCTTACGA
                      ____________________________________________________________
consensus TTGTATAATTAATTCCGTCATGGACAAGAATCAAGATCCTAGCAGCTTATATTCTTACGA
 
. : . : . : . : . : . :
rJMSF026P21+ TGCAAAGGAGAGGGGACAAGTCTCGTCCACTCGTGTCCGATATGCGCTTGCCAAAGGAGA
                      ____________________________________________________________
consensus TGCAAAGGAGAGGGGACAAGTCTCGTCCACTCGTGTCCGATATGCGCTTGCCAAAGGAGA
 
. : . : . : . : . : . :
rJMSF026P21+ TATGAAGTACGTGTCGGAGCTTTTAGGTCGCCACCACCGGCTTTTCTTGATGGTGGGAGA
                      ____________________________________________________________
consensus TATGAAGTACGTGTCGGAGCTTTTAGGTCGCCACCACCGGCTTTTCTTGATGGTGGGAGA
 
. : . : . : . : . : . :
rJMSF026P21+ CCAAGAAAAGTTTACGAGTGATAGATGTAGGGTGTCAGCTCCAAAGTCGTGTTTGTTGAA
                      ____________________________________________________________
consensus CCAAGAAAAGTTTACGAGTGATAGATGTAGGGTGTCAGCTCCAAAGTCGTGTTTGTTGAA
 
. : . : . : . : . : . :
rJMSF026P21+ TCTTTCGCCGAGGGAAGGTGTTTATGAGAATTGTTCCATTATGATAGATGAGAAAGTTAT
                      ____________________________________________________________
consensus TCTTTCGCCGAGGGAAGGTGTTTATGAGAATTGTTCCATTATGATAGATGAGAAAGTTAT
 
. : . : . : . : . : . :
rJMSF026P21+ AGCATGCAGAGTTGTGATAGACACCACGCATATTCACTTGGATTGGGATAAGCACACTTG
                      ____________________________________________________________
consensus AGCATGCAGAGTTGTGATAGACACCACGCATATTCACTTGGATTGGGATAAGCACACTTG
 
. : . : . : . : . : . :
rJMSF026P21+ TATTACTTGTCAGCAGTTAAACTTAGTTGGTATTGACATTGTGGGATAGTGTAAAGTTGA
                      ____________________________________________________________
consensus TATTACTTGTCAGCAGTTAAACTTAGTTGGTATTGACATTGTGGGATAGTGTAAAGTTGA