Previous Contig 012508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026P12Sequence578012508 (2)gb:AY183722_15879145e-06Nicotiana tabacum auxin-repressed protein-like protein (Arpl1;1) mRNA, complete 654012508 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026P12- GGTAACAGTCGTTTTACCCATCTCTAATCTTGATCTCCCCAAGATCA
                      ____________________________________________________________
consensus GGTAACAGTCGTTTTACCCATCTCTAATCTTGATCTCCCCAAGATCA
 
. : . : . : . : . : . :
JMSF026P12- TCACCTCTTTAATTCGATAAACTCTGGGACGAAACGCTTGCCGGACNGGNACCGGAGTTC
                      ____________________________________________________________
consensus TCACCTCTTTAATTCGATAAACTCTGGGACGAAACGCTTGCCGGACNGGNACCGGAGTTC
 
. : . : . : . : . : . :
JMSF026P12- GGGCTAGGCAAACTGCGCAAGGCCAAGACGTTTCAAGACCGCCCCGCCGGCGTGACGCCT
                      ____________________________________________________________
consensus GGGCTAGGCAAACTGCGCAAGGCCAAGACGTTTCAAGACCGCCCCGCCGGCGTGACGCCT
 
. : . : . : . : . : . :
JMSF026P12- CTGTCTGTATCTTTCGGTGATCCGCCCGCCTCGGCCCCCGCCACCCCCGCCGNCGGTGAT
                      ____________________________________________________________
consensus CTGTCTGTATCTTTCGGTGATCCGCCCGCCTCGGCCCCCGCCACCCCCGCCGNCGGTGAT
 
. : . : . : . : . : . :
JMSF026P12- CAGATCCCGGTTTCTCGGAGCATTTCTATCATCCGCCGCGGCAACTCCGCTTCCCCTGGC
                      ____________________________________________________________
consensus CAGATCCCGGTTTCTCGGAGCATTTCTATCATCCGCCGCGGCAACTCCGCTTCCCCTGGC
 
. : . : . : . : . : . :
JMSF026P12- TTCCACGCCGTCGATTCTCCCGGCTCCGGCCCATCTTCCCCGGCCACCTCTACCCCCACC
                      ____________________________________________________________
consensus TTCCACGCCGTCGATTCTCCCGGCTCCGGCCCATCTTCCCCGGCCACCTCTACCCCCACC
 
. : . : . : . : . : . :
JMSF026P12- ACCACTCCCACCTCCCCATTTTCACCGAGTACGCCTGGTGGGATTAATCACAAGAAATTG
rJMSF026P12+ CCCACCTCCCCATTTTCACCGAGTACGCCTGGTGGGANTAATCACAAGAAATTG
                      ____________________________________________________________
consensus ACCACTCCCACCTCCCCATTTTCACCGAGTACGCCTGGTGGGATTAATCACAAGAAATTG
 
. : . : . : . : . : . :
JMSF026P12- GNAAGGAGGAATACAACTCCAACTGGCTACGACTGGATTGTTATGAGTGCTTTGGATCGC
rJMSF026P12+ GCAAGGAGGAATACAACTCCAACTGGCTACGACTGGATTGTTATGAGTGCTTTGGATCGC
                      ____________________________________________________________
consensus GCAAGGAGGAATACAACTCCAACTGGCTACGACTGGATTGTTATGAGTGCTTTGGATCGC
 
. : . : . : . : . : . :
JMSF026P12- TGAACGGGTAAAGTCAACTCAGAATTTCTGTATCTTCTTGAACTTCGGATCAGTTAAAAC
rJMSF026P12+ TGAACGGGTAAAGTCAACTCAGAATTTCTGTATCTTCTTGAACTTCGGATCAGTTAAAAC
                      ____________________________________________________________
consensus TGAACGGGTAAAGTCAACTCAGAATTTCTGTATCTTCTTGAACTTCGGATCAGTTAAAAC
 
. : . : . : . : . : . :
JMSF026P12- CCTTACTTTTTGCTGATCTTGTGGTGACGTGTNCGAGACTTTCTAGTCTCG
rJMSF026P12+ CCTTACTTTTTGCTGATCTTGTGGTGACGTGTCCGAGACTTTCTAGTCTCGTTTTATTTT
                      ____________________________________________________________
consensus CCTTACTTTTTGCTGATCTTGTGGTGACGTGTCCGAGACTTTCTAGTCTCGTTTTATTTT
 
. : . : . : . : . : . :
rJMSF026P12+ CCTTTTTCTATTTAGGAAAAATGTATTTTCTCGATCTCGTTATAAGTCGGGTTGAGAAAA
                      ____________________________________________________________
consensus CCTTTTTCTATTTAGGAAAAATGTATTTTCTCGATCTCGTTATAAGTCGGGTTGAGAAAA
 
. : . : . : . : . : . :
rJMSF026P12+ TATCCCACCTAATATAATATGTAAATATTATATATATATATATAGTATAGTATGTGATTA
                      ____________________________________________________________
consensus TATCCCACCTAATATAATATGTAAATATTATATATATATATATAGTATAGTATGTGATTA
 
. : . : . : . : . : . :
rJMSF026P12+ AGGATGTGTACTGTGTGAAAGTACACTGTAAATATGTGTGAGTGATTATATATGTATGTA
                      ____________________________________________________________
consensus AGGATGTGTACTGTGTGAAAGTACACTGTAAATATGTGTGAGTGATTATATATGTATGTA
 
. : . : . : . : . : . :
rJMSF026P12+ TATGTGAGTGTTAGAGGTTATGAAGAGGAATCATGAGCTGATTGAGCTCGTAGGATATAT
                      ____________________________________________________________
consensus TATGTGAGTGTTAGAGGTTATGAAGAGGAATCATGAGCTGATTGAGCTCGTAGGATATAT
 
. : . : . : . : . : . :
rJMSF026P12+ ACGAGGAAGTTGTGATCGATGTGGCATAAATAAGTAGTAGATCGGAAGAGTTTGCTGCTN
                      ____________________________________________________________
consensus ACGAGGAAGTTGTGATCGATGTGGCATAAATAAGTAGTAGATCGGAAGAGTTTGCTGCTN
 
. : . : . : . : . : . :
rJMSF026P12+ AGCTTGAAGATGGAAGACCAGACCAGCTCCCGGCGGCGCGTGGCTGGAGACCGGCCGGAG
                      ____________________________________________________________
consensus AGCTTGAAGATGGAAGACCAGACCAGCTCCCGGCGGCGCGTGGCTGGAGACCGGCCGGAG
 
. : . : . : . : . : . :
rJMSF026P12+ CGTGTGTTTGTTTCTGTTNTTTTGTGTTTATGTTTTGTCCTTTTTGTAATGAAATGCATT
                      ____________________________________________________________
consensus CGTGTGTTTGTTTCTGTTNTTTTGTGTTTATGTTTTGTCCTTTTTGTAATGAAATGCATT