Previous Contig 012507:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009M10Sequence314006500 (5)gb:OSJN00064_16941902e-18Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089K24, complete seque810012507 (4)pir|T04187|T041873e-71subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29
JMSF026P09Sequence657006500 (5)pir|T04187|T041872e-59subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29773012507 (4)pir|T04187|T041872e-65subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29
JMSF027O23Sequence592006500 (5)gb:F3H7_16782602e-51Arabidopsis thaliana BAC F3H7.699012507 (4)pir|T04187|T041871e-54subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29
JMSF028K24Sequence676006500 (5)pir|T04187|T041871e-54subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29698012507 (4)pir|T04187|T041872e-56subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009M10+ CCNGG
                      ____________________________________________________________
consensus CCNGG
 
. : . : . : . : . : . :
rJMSF009M10+ AACAAATATTTTAGCAGCATATGTTCCTGAAAATCCTAATATACGAATAAGTACATATAA
                      ____________________________________________________________
consensus AACAAATATTTTAGCAGCATATGTTCCTGAAAATCCTAATATACGAATAAGTACATATAA
 
. : . : . : . : . : . :
rJMSF009M10+ GATTATCAGTGGAACATCTATGGCAACACCACATGTGGCAGGAATAGTTGCACTACTCAA
rJMSF026P09+ ACATCTATGGCAACACCACATGTGGCAGGAATAGGTGCACTACTCAA
                      ____________________________________________________________
consensus GATTATCAGTGGAACATCTATGGCAACACCACATGTGGCAGGAATAGTTGCACTACTCAA
 
. : . : . : . : . : . :
rJMSF009M10+ AGCTGCTAACCCAAATTGGTCTCCGGCAGCTATAAAATCCGCAATTGTCACAACAGCATG
rJMSF028K24+ CTCCGGCAGCTATAAAATCCGCAATTGTCACAACAGCATG
rJMSF027O23+ CTCCGGCAGCTAT-AAATCCGCAATTGTCACCACAGCATG
rJMSF026P09+ AGCTGCTAACCCAAATTGGTCTCCGGCAGCTATAAAATCCGCAATTGTCACAACAGCATG
                      ____________________________________________________________
consensus AGCTGCTAACCCAAATTGGTCTCCGGCAGCTATAAAATCCGCAATTGTCACAACAGCATG
 
. : . : . : . : . : . :
rJMSF009M10+ GACAAGTGACCCATCATCTGGACAACCTATATTCAATGAAGGAGAGACAATCAGTAAATT
rJMSF028K24+ GACAAGTGACCCATCATCTGGACAACCTATATTCAATGAAGGAGAGACAATCAGTAAATT
rJMSF027O23+ GACAAGTGACCCATCATCTGGACAACCTATATTCAATGAAGGAGAGACAATCAGTAAATT
rJMSF026P09+ GACAAGTGACCCATCATCTGGACAACCTATATTCAATGAAGGAGAGACAATCAGTAAATT
                      ____________________________________________________________
consensus GACAAGTGACCCATCATCTGGACAACCTATATTCAATGAAGGAGAGACAATCAGTAAATT
 
. : . : . : . : . : . :
rJMSF009M10+ GGCAGATGCATTTGACCATGGGGGAGGGATCATAAACCCCAACAAAGCAAGATCTCCCGG
rJMSF028K24+ GGCAGATGCATTTGACCATGGGGGAGGGATCATAAACCCCAACAAAGCAAGATCTCCCGG
rJMSF027O23+ GGCAGATGCATTTGACCATGGGGGAGGGATCATAAACCCCAACAAAGCAAGATCTCCCGG
rJMSF026P09+ GGCAGATGCATTTGACCATGGGGGAGGGATCATAAACCCCAACAAAGCAAGATCTCCCGG
                      ____________________________________________________________
consensus GGCAGATGCATTTGACCATGGGGGAGGGATCATAAACCCCAACAAAGCAAGATCTCCCGG
 
. : . : . : . : . : . :
rJMSF009M10+ CCTCATCTACGACATGAGCACAACAGATTATCTTCAGTGCCTATGTGCCATGGGATATGA
rJMSF028K24+ CCTCATCTACGACATGAGCACAACAGATTATCTTCAGTGCCTATGTGCCATGGGATATGA
rJMSF027O23+ CCTCATCTACGACATGAGCACAACAGATTATCTTCAGTGCCTATGTGCCATGGGATATGA
rJMSF026P09+ CCTCATCTACGACATGAGCACAACAGATTATCTTCAGTGCCTATGTGCCATGGGATATGA
                      ____________________________________________________________
consensus CCTCATCTACGACATGAGCACAACAGATTATCTTCAGTGCCTATGTGCCATGGGATATGA
 
. : . : . : . : . : . :
rJMSF009M10+ CAGTAGGGTCATTAGTGGACTTGCAGGGCAAGCCACATCTTGCAATAATGGGCTTTCCAT
rJMSF028K24+ CAGTAGGGTCATTAGTGGACTTGCAGGGCAAGCCACATCTTGCAATAATGGGCTTTCCAT
rJMSF027O23+ CAGTAGGGTCATTAGTGGACTTGCAGGGCAAGCCACATCTTGCAATAATGGGCTTTCCAT
rJMSF026P09+ CAGTAGGGTCATTAGTGGACTTGCAGGGCAAGCCACATCTTGCAATAATGGGCTTCCCAT
                      ____________________________________________________________
consensus CAGTAGGGTCATTAGTGGACTTGCAGGGCAAGCCACATCTTGCAATAATGGGCTTTCCAT
 
. : . : . : . : . : . :
rJMSF009M10+ TTTTGATGTGAATTTTCCTTCGATAACCATGCCAAATCTAAACGGAACAGTCACTCTCAC
rJMSF028K24+ TTTTGATGTGAATTTTCCTTCGATAACCATGCCAAATCTAAACGGAACAGTCACTCTCAC
rJMSF027O23+ TTTTGATGTGAATTTTCCTTCGATAACCATGCCAAATCTAAACGGAACAGTCACTCTCAC
rJMSF026P09+ TTTTGATGTGAATTTTCCTTCGATAACCATGCCAAATCTAAACGGAACAGTCACTCTCAC
                      ____________________________________________________________
consensus TTTTGATGTGAATTTTCCTTCGATAACCATGCCAAATCTAAACGGAACAGTCACTCTCAC
 
. : . : . : . : . : . :
rJMSF009M10+ TAGAACTGTGACAAATGTTGGACCTGTAAACTCGGTATACAAAGTTATGGTTGAACCTCC
rJMSF028K24+ TAGAACTGTGACAAATGTTGGACCTGTAAACTCGGTATACAAAGTTATGGTTGAACCTCC
rJMSF027O23+ TAGAACTGTGACAAATGTTGGACCTGTAAACTCGGTATACAAAGTTATGGTTGAACCTCC
rJMSF026P09+ TAGAACTGTGACAAATGTTGGACCTGTAAACTCGGTATACAAAGTTATGGTTGAACCTCC
                      ____________________________________________________________
consensus TAGAACTGTGACAAATGTTGGACCTGTAAACTCGGTATACAAAGTTATGGTTGAACCTCC
 
. : . : . : . : . : . :
rJMSF009M10+ AAAGGGAATAACAGTATCTGTAACACCAAGTACACTAAACTTTAATCCCAGCGTCAAGAA
rJMSF028K24+ AAAGGGAATAACAGTATCTGTAACACCAAGTACACTAAACTTTAATCCCAGCGTCAAGAA
rJMSF027O23+ AAAGGGAATAACAGTATCTGTAACACCAAGTACACTAAACTTTAATCCCAGCGTCAAGAA
rJMSF026P09+ AAAGGGAATAACAGTATCTGTAACACCAAGTACACTAAACTTTAATCCCAGCGTCAAGAA
                      ____________________________________________________________
consensus AAAGGGAATAACAGTATCTGTAACACCAAGTACACTAAACTTTAATCCCAGCGTCAAGAA
 
. : . : . : . : . : . :
rJMSF009M10+ GATCTCCTTCAGTGTAAAAATTTCCACGAGCTATCTCTTCAACACGGGATACTATTTTGG
rJMSF028K24+ GATCTCCTTCAGTGTAAAAATTTCCACGAGCTATCTCTTCAACACGGGATACTATTTTGG
rJMSF027O23+ GATCTCCTTCAGTGTAAAAATTTCCACGAGCTATCTCTTCAACACGGGATACTATTTTGG
rJMSF026P09+ GATCTCCTTCAGTGTAAAAATTTCCACGAGCTATCTCTTCAACACGGGATACTATTTTGG
                      ____________________________________________________________
consensus GATCTCCTTCAGTGTAAAAATTTCCACGAGCTATCTCTTCAACACGGGATACTATTTTGG
 
. : . : . : . : . : . :
rJMSF009M10+ GAGCTTAACTTGGAATGATGGGGTGAATAATGTCAGAATTCCTATATCTGTCAAGACAAT
rJMSF028K24+ GAGCTTAACTTGGAATGATGGGGTGAATAATGTCAGAATTCCTATATCTGTCAAGACAAT
rJMSF027O23+ GAGCTTAACTTGGAATGATGGGGTGAATAATGTCAGAATTCCTATATCTGTCAAGACAAT
rJMSF026P09+ GAGCTTAACTTGGAATGATGGGGTGAATAATGTCAGAATTCCTATATCTGTCAAGACAAT
                      ____________________________________________________________
consensus GAGCTTAACTTGGAATGATGGGGTGAATAATGTCAGAATTCCTATATCTGTCAAGACAAT
 
. : . : . : . : . : . :
rJMSF009M10+ GTATTAAGTAAGAATCAAGATACTATTATGGGAGCTTGACTTAGAATGATATGGTGTATA
rJMSF028K24+ GTATTAAGTAAGAATCAAGATACTATTATGGGAGCTTGACTTAGAATGATATGGTGTATA
rJMSF027O23+ GTATTAAGTAAGAATCAAGATACTATTATGGGAGCTTGACTTAGAATGATATGGTGTATA
rJMSF026P09+ GTATTAAGTAAGAATCAAGATACTATTATGGGAGCTTGACTTAGAATGATATGGTGTATA
                      ____________________________________________________________
consensus GTATTAAGTAAGAATCAAGATACTATTATGGGAGCTTGACTTAGAATGATATGGTGTATA
 
. : . : . : . : . : . :
rJMSF009M10+ GTGTGAGAATTCCCTATATATCTGA
rJMSF028K24+ GTGTGAGAATT-CCTATATATCTGATAACACTATGTATTAATAATCTGAATTGATGCTA
rJMSF027O23+ GTGTGAGAATT-CCTATATATCTGATAACACTATGTATTAATAATCTGAATTGATGCTA
rJMSF026P09+ GTGTGAGAATT-CCTATATATCTGATAACACTATGTATTAATAATCTGAATTGATGCTAT
                      ____________________________________________________________
consensus GTGTGAGAATT-CCTATATATCTGATAACACTATGTATTAATAATCTGAATTGATGCTAT