Previous Contig 012497:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026M17Sequence639006410 (2)pir|T48214|T482141e-69endo-1,4-beta-mannosidase-like protein - Arabidopsis thaliana>gb:ATT20L15_155504656012497 (2)pir|T48214|T482146e-63endo-1,4-beta-mannosidase-like protein - Arabidopsis thaliana>gb:ATT20L15_155504
JMSF034A20Sequence676006410 (2)pir|T48214|T482144e-75endo-1,4-beta-mannosidase-like protein - Arabidopsis thaliana>gb:ATT20L15_155504620012497 (2)pir|T48214|T482143e-59endo-1,4-beta-mannosidase-like protein - Arabidopsis thaliana>gb:ATT20L15_155504

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034A20+ ATGCCACACAAGTTGGAACA
rJMSF026M17+ TCAACGCCGAACCGGCTCAATTCAACCCCAACACNTATGCCACACAAGTTGGAACA
                      ____________________________________________________________
consensus TCAACGCCGAACCGGCTCAATTCAACCCCAACACNTATGCCACACAAGTTGGAACA
 
. : . : . : . : . : . :
rJMSF034A20+ GACTTCATCAGAAATCATATGGCTCTTGGAGTTGATTTTGCTTCTGCCCACATCTACCCA
rJMSF026M17+ GACTTCATCAGAAATCATATGGCTCTTGGAGTTGATTTTGCTTCTGCCCACATCTACCCA
                      ____________________________________________________________
consensus GACTTCATCAGAAATCATATGGCTCTTGGAGTTGATTTTGCTTCTGCCCACATCTACCCA
 
. : . : . : . : . : . :
rJMSF034A20+ GACACTTGGATTTCACAGAACATAACAGATGCCCATGTGGAGTTCACCAAGACATGGATG
rJMSF026M17+ GACACTTGGATTTCACAGAACATAACAGATGCCCATGTGGAGTTCACCAAGACATGGATG
                      ____________________________________________________________
consensus GACACTTGGATTTCACAGAACATAACAGATGCCCATGTGGAGTTCACCAAGACATGGATG
 
. : . : . : . : . : . :
rJMSF034A20+ CAATCCCACATCGAAGACGCCGAGAGCTACCTGGGAATGCCGATCATCTTCGCCGAGTTC
rJMSF026M17+ CAATCCCACATCGAAGACGCCGAGAGCTACCTGGGAATGCCGATCATCTTCGCCGAGTTC
                      ____________________________________________________________
consensus CAATCCCACATCGAAGACGCCGAGAGCTACCTGGGAATGCCGATCATCTTCGCCGAGTTC
 
. : . : . : . : . : . :
rJMSF034A20+ GGCGTCTGCACGAAAGATCCCGGCTTCAACGCCACTTACAGAGACACCATTCTCAGCACC
rJMSF026M17+ GGCGTCTGCACGAAAGATCCCGGCTTCAACGCCACTTACAGAGACACCATTCTCAGCACC
                      ____________________________________________________________
consensus GGCGTCTGCACGAAAGATCCCGGCTTCAACGCCACTTACAGAGACACCATTCTCAGCACC
 
. : . : . : . : . : . :
rJMSF034A20+ GTGTACAAGAGCATCTTGAACTCCACCAAGAAAGGCGGTGGGGGCGCCGGCGCCCTTCTG
rJMSF026M17+ GTGTACAAGAGCATCTTGAACTCCACCAAGAAAGGCGGTGGGGGCGCCGGCGCCCTTCTG
                      ____________________________________________________________
consensus GTGTACAAGAGCATCTTGAACTCCACCAAGAAAGGCGGTGGGGGCGCCGGCGCCCTTCTG
 
. : . : . : . : . : . :
rJMSF034A20+ TGGCAGCTCTTCCCTGAAGGAACAGAGTACATGGACGATGGGTACGCAATAGTTCTCTCA
rJMSF026M17+ TGGCAGCTCTTCCCTGAAGGAACAGAGTACATGGACGATGGGTACGCAATAGTTCTCTCA
                      ____________________________________________________________
consensus TGGCAGCTCTTCCCTGAAGGAACAGAGTACATGGACGATGGGTACGCAATAGTTCTCTCA
 
. : . : . : . : . : . :
rJMSF034A20+ AAATCTGCCTCCACATCGGACATTATCTCTCTGCATTCCAAGAGGCTCAGAGCTTTCAAC
rJMSF026M17+ AAATCTGCCTCCACATCGGACATTATCTCTCTGCATTCCAAGAGGCTCAGAGCTTTCAAC
                      ____________________________________________________________
consensus AAATCTGCCTCCACATCGGACATTATCTCTCTGCATTCCAAGAGGCTCAGAGCTTTCAAC
 
. : . : . : . : . : . :
rJMSF034A20+ TCCCTGTGTTCATGGAAATGCCACTGGGGTTGCAAGAAGAAGCAGGTGCTGGATACTTTC
rJMSF026M17+ TCCCTGTGTTCATGGAAATGCCACTGGGGTTGCAAGAAGAAGCAGGTGCTGGATACTTTC
                      ____________________________________________________________
consensus TCCCTGTGTTCATGGAAATGCCACTGGGGTTGCAAGAAGAAGCAGGTGCTGGATACTTTC
 
. : . : . : . : . : . :
rJMSF034A20+ CTTGGCCGTGATGAGCTTTAGAATCACTTATATACTGTAATGATTATCCACCATCATGGA
rJMSF026M17+ CTTGGCCGTGATGAGCTTTAGAATCACTTATATACTGTAATGATTATCCACCATCATGGA
                      ____________________________________________________________
consensus CTTGGCCGTGATGAGCTTTAGAATCACTTATATACTGTAATGATTATCCACCATCATGGA
 
. : . : . : . : . : . :
rJMSF034A20+ TCATCTGTGATTAATACTGGGTTCATGTAATATGATCTGAACAATAATAAAGTCATATAT
rJMSF026M17+ TCATCTGTGATTAATACTGGGTTCATGTAATATGATCTGAACAATAATAAAGTCATATAT
                      ____________________________________________________________
consensus TCATCTGTGATTAATACTGGGTTCATGTAATATGATCTGAACAATAATAAAGTCATATAT