Previous Contig 012494:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026L19Sequence650006402 (4)gb:AF320248_17858342e-39Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2) 786012494 (3)gb:AF320248_17858341e-05Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2)
JMSF029K06Sequence665006402 (4)gb:AF320248_17858343e-44Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2) 763012494 (3)gb:AF320248_17858349e-06Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2)
JMSF033M04Sequence656006402 (4)gb:AF320248_17858346e-45Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2) 740012494 (3)gb:AF320248_17858349e-06Arabidopsis thaliana phragmoplast-associated kinesin-related protein 2 (PAKRP2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029K06+ GAAGAAGAAGACGGGGAGAT
                      ____________________________________________________________
consensus GAAGAAGAAGACGGGGAGAT
 
. : . : . : . : . : . :
rJMSF029K06+ CATATAACAAATGCTCCACCGACGAGGAGGTGCAGAAAGAGGTAGTCGAGGAGAAGACAA
rJMSF033M04+ ACCGACGAGGAGGTGCAGAAAGAGGTAGTCGAGGAGAAGACAA
rJMSF026L19+ ATAACAAATGCTCCACCGACGAGGAGGTGCAGAAAGAGGTAGTCGAGGAGAAGACAA
                      ____________________________________________________________
consensus CATATAACAAATGCTCCACCGACGAGGAGGTGCAGAAAGAGGTAGTCGAGGAGAAGACAA
 
. : . : . : . : . : . :
rJMSF029K06+ TATGTTCAAGTGCAGTTGTGGGTATGCCAGCAGATATGTTGAGCCAAATAGGCAACCTTT
rJMSF033M04+ TATGTTCAAGTGCAGTTGTGGGTATGCCAGCAGATATGTTGAGCCAAATAGGCAACCTTT
rJMSF026L19+ TATGTTCAAGTGCAGTTGTGGGTATGCCAGCAGATATGTTGAGCCAAATAGGCAACCTTT
                      ____________________________________________________________
consensus TATGTTCAAGTGCAGTTGTGGGTATGCCAGCAGATATGTTGAGCCAAATAGGCAACCTTT
 
. : . : . : . : . : . :
rJMSF029K06+ TAGTGGAAAAATCTTCTGCAAATGAAGAGGATGCAGAAGGGGCCTCATATAGGGAAAGAA
rJMSF033M04+ TAGTGGAAAAATCTTCTGCAAATGAAGAGGATGCAGAAGGGGCCTCATATAGGGAAAGAA
rJMSF026L19+ TAGTGGAAAAATCTTCTGCAAATGAAGAGGATGCAGAAGGGGCCTCATATAGGGAAAGAA
                      ____________________________________________________________
consensus TAGTGGAAAAATCTTCTGCAAATGAAGAGGATGCAGAAGGGGCCTCATATAGGGAAAGAA
 
. : . : . : . : . : . :
rJMSF029K06+ GAATACAGAACATATTCACTCTCTGTGGAAACTATAGAGAAATGTCTCAAAACATGAGAG
rJMSF033M04+ GAATACAGAACATATTCACTCTCTGTGGAAACTATAGAGAAATGTCTCAAAACATGAGAG
rJMSF026L19+ GAATACAGAACATATTCACTCTCTGTGGAAACTATAGAGAAATGTCTCAAAACATGAGAG
                      ____________________________________________________________
consensus GAATACAGAACATATTCACTCTCTGTGGAAACTATAGAGAAATGTCTCAAAACATGAGAG
 
. : . : . : . : . : . :
rJMSF029K06+ AAACTCCTATGCTTGACAGTGGCTATTTGTCATCATCCCCTCCTCCAGCCAAGACAATTC
rJMSF033M04+ AAACTCCTATGCTTGACAGTGGCTATTTGTCATCATCCCCTCCTCCAGCCAAGACAATTC
rJMSF026L19+ AAACTCCTATGCTTGACAGTGGCTATTTGTCATCATCCCCTCCTCCAGCCAAGACAATTC
                      ____________________________________________________________
consensus AAACTCCTATGCTTGACAGTGGCTATTTGTCATCATCCCCTCCTCCAGCCAAGACAATTC
 
. : . : . : . : . : . :
rJMSF029K06+ AAGAGCATTCTGCGACAAAGAGTGTCTCAAATGAACATAAATCAGCTGAAAAGAACACGA
rJMSF033M04+ AAGAGCATTCTGCGACAAAGAGTGTCTCAAATGAACATAAATCAGCTGAAAAGAACACGA
rJMSF026L19+ AAGAGCATTCTGCGACAAAGAGTGTCTCAAATGAACATAAATCAGCTGAAAAGAACACGA
                      ____________________________________________________________
consensus AAGAGCATTCTGCGACAAAGAGTGTCTCAAATGAACATAAATCAGCTGAAAAGAACACGA
 
. : . : . : . : . : . :
rJMSF029K06+ ATCTCTTTGAAGCAAAGGATTTGAAAGAGAACTTCAACCCATCAGATGAAAACAGCCGCG
rJMSF033M04+ ATCTCTTTGAAGCAAAGGATTTGAAAGAGAACTTCAACCCATCAGATGAAAACAGCCGCG
rJMSF026L19+ ATCTCTTTGAAGCAAAGGATTTGAAAGAGAACTTCAACCCATCAGATGAAAACAGCCGCG
                      ____________________________________________________________
consensus ATCTCTTTGAAGCAAAGGATTTGAAAGAGAACTTCAACCCATCAGATGAAAACAGCCGCG
 
. : . : . : . : . : . :
rJMSF029K06+ ATTTGGAAGTGTATGTTAAATGGACCCCTTCAAAGGATTCATCAGGCGCACCGGGGCCTA
rJMSF033M04+ ATTTGGAAGTGTATGTTAAATGGACCCCTTCAAAGGATTCATCAGGCGCACCGGGGCCTA
rJMSF026L19+ ATTTGGAAGTGTATGTTAAATGGACCCCTTCAAAGGATTCATCAGGCGCACCGGGGCCTA
                      ____________________________________________________________
consensus ATTTGGAAGTGTATGTTAAATGGACCCCTTCAAAGGATTCATCAGGCGCACCGGGGCCTA
 
. : . : . : . : . : . :
rJMSF029K06+ AAGAACAGCAGGAAGCCAGAACATCGGCAAGCAAGCTTCCCACTTGCAACAACAATCAAT
rJMSF033M04+ AAGAACAGCAGGAAGCCAGAACATCGGCAAGCAAGCTTCCCACTTGCAACAACAATCAAT
rJMSF026L19+ AAGAACAGCAGGAAGCCAGAACATCGGCAAGCAAGCTTCCCACTTGCAACAACAATCAAT
                      ____________________________________________________________
consensus AAGAACAGCAGGAAGCCAGAACATCGGCAAGCAAGCTTCCCACTTGCAACAACAATCAAT
 
. : . : . : . : . : . :
rJMSF029K06+ TACACGGCGGCCACCTCAATCAGCTCCCTCTCGGCCAAGTACAGAATTTACTTCCTGTTG
rJMSF033M04+ TGCACGGCGGCCACCTCAATCAGCTCCCTCTCGGCCAAGTACAGAATTTACTTCCTGTTG
rJMSF026L19+ TACACGGCGGCCACCTCAATCAGCTCCCTCTCGGCCAAGTACAGAATTTACTTCCTGTTG
                      ____________________________________________________________
consensus TACACGGCGGCCACCTCAATCAGCTCCCTCTCGGCCAAGTACAGAATTTACTTCCTGTTG
 
. : . : . : . : . : . :
rJMSF029K06+ ATGGCTTTTGAGCCAAAATGGCAGATGATGATGCGCTGTTGGTGCATTTTGGGTTCATTT
rJMSF033M04+ ATGGCTTTTGAGCCAAAATGGCAGATGATGATGCGCTGTTGGTGCATTTTGGGTTCATTT
rJMSF026L19+ ATGGCTTTTGAGCCAAAATGGCAGATGATGATGCGCTGTTGGTGCATTTTGGGTTCATTT
                      ____________________________________________________________
consensus ATGGCTTTTGAGCCAAAATGGCAGATGATGATGCGCTGTTGGTGCATTTTGGGTTCATTT
 
. : . : . : . : . : . :
rJMSF029K06+ TCTTGTGTATCTTGTACTAGTTATCAGTCAGTTGATGTGTATTTTTTGGGGTTTTTGTTT
rJMSF033M04+ TCTTGTGTATCTTGTACTAGTTATCAGTCAGTTGATGTGTATTTTTTGGGGTTTTTGTTT
rJMSF026L19+ TCTTGTGTATCTTGTACTAGTTATCAGTCAGTTGATGTGTATTTTTTGGGGTTTTTGTTT
                      ____________________________________________________________
consensus TCTTGTGTATCTTGTACTAGTTATCAGTCAGTTGATGTGTATTTTTTGGGGTTTTTGTTT
 
. : . : . : . : . : . :
rJMSF029K06+ TCACTGTTCATATGGGAATTCAG
rJMSF033M04+ TCACTGTTCATATGGGAATTCAGTATCAGTCTGACCA
rJMSF026L19+ TCACTGTTCATATGGGAATTCAGTATCAGTCTGACCATGTTCTAATGAAGTAAAAACTTC
                      ____________________________________________________________
consensus TCACTGTTCATATGGGAATTCAGTATCAGTCTGACCATGTTCTAATGAAGTAAAAACTTC