Previous Contig 012486:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042C12Sequence648003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060594012486 (3)gb:AP004464_18414434e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P066
JMSF026K12Sequence663006395 (2)gb:AY714244_16240161e-61Pisum sativum MtN19-like protein mRNA, complete cds.674012486 (3)gb:AY714244_16240161e-26Pisum sativum MtN19-like protein mRNA, complete cds.
JMSF035F05Sequence628006395 (2)gb:AY714244_16240163e-54Pisum sativum MtN19-like protein mRNA, complete cds.773012486 (3)gb:AY714244_16240164e-47Pisum sativum MtN19-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035F05+ AACNGGGTACAATTCN
                      ____________________________________________________________
consensus AACNGGGTACAATTCN
 
. : . : . : . : . : . :
rJMSF035F05+ ATGCACCACTGCAAGATTGAATACAGTGTGGAGCCTTGTTCCACTGCAGCAGCTAAGAGT
                      ____________________________________________________________
consensus ATGCACCACTGCAAGATTGAATACAGTGTGGAGCCTTGTTCCACTGCAGCAGCTAAGAGT
 
. : . : . : . : . : . :
rJMSF035F05+ GGATGTGTTCATACTAAAAGATTAAGTGTGAGTTTTCCAAGTGGTGGGGATGTTATCTAT
                      ____________________________________________________________
consensus GGATGTGTTCATACTAAAAGATTAAGTGTGAGTTTTCCAAGTGGTGGGGATGTTATCTAT
 
. : . : . : . : . : . :
rJMSF035F05+ GGTGTTGCACACCAGCACACAGGGGGTACTGGTTCTACTCTTTACGGGGAGGATGGACGG
rJMSF026K12+ GGGGAGGATGGACGG
                      ____________________________________________________________
consensus GGTGTTGCACACCAGCACACAGGGGGTACTGGTTCTACTCTTTACGGGGAGGATGGACGG
 
. : . : . : . : . : . :
rJMSF035F05+ GCCATATGCTCATCGCTTCCAATCTATGGAGAAGGAATGGAACCGGGAAATGAATCTGGC
rJMFF042C12+ C
rJMSF026K12+ GCCATATGCTCATCGCTTCCAATCTATGGAGAAGGAATGGAACCGGGAAATGAATCTGGC
                      ____________________________________________________________
consensus GCCATATGCTCATCGCTTCCAATCTATGGAGAAGGAATGGAACCGGGAAATGAATCTGGC
 
. : . : . : . : . : . :
rJMSF035F05+ TATATTGTAGGAATGACAACCTGCTATCCTCAACCTGGCACGGTCAAGATTGCTGACGGG
rJMFF042C12+ TATATTGTAGGAATGACAACCTGCTATCCTCAACCTGGCACGGTCAAGATTGCTGACGGG
rJMSF026K12+ TATATTGTAGGAATGACAACCTGCTATCCTCAACCTGGCACGGTCAAGATTGCNGACGGG
                      ____________________________________________________________
consensus TATATTGTAGGAATGACAACCTGCTATCCTCAACCTGGCACGGTCAAGATTGCTGACGGG
 
. : . : . : . : . : . :
rJMSF035F05+ GAGTCTCTGACCATTGTGTCTAATTATAGCAGCCATCAAAGCCATACCGGAGTCATGGGG
rJMFF042C12+ GAGTCTCTGACCATTGTGTCTAATTATAGCAGCCATCAAAGCCATACCGGAGTCATGGGG
rJMSF026K12+ GAGTCTCTGACCATTGTGTCTAATTATAGCAGCCATCAAAGCCATACCGGAGTCATGGGG
                      ____________________________________________________________
consensus GAGTCTCTGACCATTGTGTCTAATTATAGCAGCCATCAAAGCCATACCGGAGTCATGGGG
 
. : . : . : . : . : . :
rJMSF035F05+ CTTTTCTACATTTTAGTTGCTGATCCGGTACCAGAATCTCGTTCTTTCCTTCGTTCTCAA
rJMFF042C12+ CTTTTCTACATTTTAGTTGCTGATCCGGTACCAGAATCTCGTTCTTTCCTTCGTTCTCAA
rJMSF026K12+ CTTTTCTACATTTTAGTTGCTGATCCGGTACCAGAATCTCGTTCTTTCCTTCGTTCTCAA
                      ____________________________________________________________
consensus CTTTTCTACATTTTAGTTGCTGATCCGGTACCAGAATCTCGTTCTTTCCTTCGTTCTCAA
 
. : . : . : . : . : . :
rJMSF035F05+ ATTAAGGGTGGTGAGATGATGATACTACCAAATGCTATTTTGATTTTAGCATTTGTTGGA
rJMFF042C12+ ATTAAGGGTGGTGAGATGATGATACTACCAAATGCTATTTTGATTTTAGCATTTGTTGGA
rJMSF026K12+ ATTAAGGGTGGTGAGATGATGATACTACCAAATGCTATTTTGATTTTAGCATTTGTTGGA
                      ____________________________________________________________
consensus ATTAAGGGTGGTGAGATGATGATACTACCAAATGCTATTTTGATTTTAGCATTTGTTGGA
 
. : . : . : . : . : . :
rJMSF035F05+ ATTGCAGTGCTTGGTGTTGCTGTTATTATGAGTCGGCGTCGGGGTGAAAGGGAGAATGAT
rJMFF042C12+ ATTGCAGTGCTTGGTGTTGCTGTTATTATGAGTCGGCGTCGGGGTGAAAGGGAGAATGAT
rJMSF026K12+ ATTGCAGTGCTTGGTGTTGCTGTTATTATGAGTCGGCGTCGGGGTGAAAGGGAGAATGAT
                      ____________________________________________________________
consensus ATTGCAGTGCTTGGTGTTGCTGTTATTATGAGTCGGCGTCGGGGTGAAAGGGAGAATGAT
 
. : . : . : . : . : . :
rJMSF035F05+ TATGAACCTATAGTGATGTGAGGGAGGCTTTGCCTTAGATTGAGAATTGATGCTTAATTA
rJMFF042C12+ TATGAACCTATAGTGATGTGAGGGAGGCTTTGCCTTAGATTGAGAATTGATGCTTAATTA
rJMSF026K12+ TATGAACCTATAGTGATGTGAGGGAGGCTTTGCCTTAGATTGAGAANTGATGCTTAATTA
                      ____________________________________________________________
consensus TATGAACCTATAGTGATGTGAGGGAGGCTTTGCCTTAGATTGAGAATTGATGCTTAATTA
 
. : . : . : . : . : . :
rJMSF035F05+ AATCCAATCCAACATGTGATGTGTTTAGCACTTTGTTAATCACATGTAAGTTAGTTTTAT
rJMFF042C12+ AATCCAATCCAACATGTGATGTGTTTAGCACTTTGTTAATCACATGTAAGTTAGTTTTAT
rJMSF026K12+ AATCCAATCCAACATGTGATGTGTTTAGCACTTTGTTAATCACATGTAAGTTAGTTTTAT
                      ____________________________________________________________
consensus AATCCAATCCAACATGTGATGTGTTTAGCACTTTGTTAATCACATGTAAGTTAGTTTTAT
 
. : . : . : . : . : . :
rJMSF035F05+ AATAAGGTGGATTGCAATGTCATATATTTTGTATTCTGTAAGTTGTATAAAGTTGTATGC
rJMFF042C12+ AATAAGGTGGATTGCAATGTCATATATTTTGTATTCTGTAAGTTGTAT-AAGTTGTATGC
rJMSF026K12+ AATAAGGTGGATTGCAATGTCATATATTTTGTATTCTGTAAGTNGTAT-AAGTTGTATGC
                      ____________________________________________________________
consensus AATAAGGTGGATTGCAATGTCATATATTTTGTATTCTGTAAGTTGTAT-AAGTTGTATGC
 
. : . : . : . : . : . :
rJMSF035F05+ TTTCTTTTATATACCTCTCTAC
rJMFF042C12+ TTTCTTTTATATACCTCTCTACAAAGTACGAGATACAACTTTACAGAACACATAAAAAAA
rJMSF026K12+ TTTCTTTTATATACCTCTCTACAAAGTACGAGATACAACTTTACAGAACACATAAAAAAA
                      ____________________________________________________________
consensus TTTCTTTTATATACCTCTCTACAAAGTACGAGATACAACTTTACAGAACACATAAAAAAA
 
. : . : . : . : . : . :
rJMFF042C12+ TTTCGGTAATTTCCTTAAAATGTACGGAGTAATGTATAAAGAGTTGTCTTTGAG
rJMSF026K12+ TTTCGGTAATTTCCTTAAAATGTACGGAGTAATGTATAAAGAGTNGTCTTTGAGAATTGC
                      ____________________________________________________________
consensus TTTCGGTAATTTCCTTAAAATGTACGGAGTAATGTATAAAGAGTTGTCTTTGAGAATTGC