Previous Contig 012484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013C14Sequence531007999 (9)gb:AF307144_17846553e-55Spinacia oleracea cytosolic 6-phosphogluconate dehydrogenase (pgdC) mRNA, comple659012484 (7)gb:AC068900_15404786e-77Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence
JMFF039I11Sequence522007999 (9)gb:AF307144_17846552e-53Spinacia oleracea cytosolic 6-phosphogluconate dehydrogenase (pgdC) mRNA, comple708012484 (7)gb:AC068900_15404788e-83Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence
JMFF042M19Sequence658007999 (9)gb:AF307144_17846556e-66Spinacia oleracea cytosolic 6-phosphogluconate dehydrogenase (pgdC) mRNA, comple609012484 (7)gb:AC068900_15404781e-61Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence
JMSF005M19Sequence334004745 (9)gb:AP003436_18293743e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P047297012484 (7)gb:AP001552_18213474e-16Oryza sativa (japonica cultivar-group) geneomic DNA, chromosome 6, PAC clone:P00
JMSF026J11Sequence669007999 (9)pir|S57786|S577863e-93phosphogluconate dehydrogenase (decarboxylating) (EC 1.1.1.44) - alfalfa>gb:MSU1779012484 (7)gb:AC068900_15404782e-97Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence
JMSF031I05Sequence658007999 (9)pir|S57786|S577863e-94phosphogluconate dehydrogenase (decarboxylating) (EC 1.1.1.44) - alfalfa>gb:MSU1723012484 (7)gb:AC068900_15404782e-88Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence
JMSF052M15Sequence679007999 (9)pir|S57786|S577861e-82phosphogluconate dehydrogenase (decarboxylating) (EC 1.1.1.44) - alfalfa>gb:MSU1914012484 (7)gb:AC068900_1540478e-105Arabidopsis thaliana chromosome 3 BAC F11A12 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052M15+ GANTGAAATCACAGCTTGAT
                      ____________________________________________________________
consensus GANTGAAATCACAGCTTGAT
 
. : . : . : . : . : . :
rJMSF052M15+ ATATTTGGAATCAAGGATGACAAGGCGGATGGGTATTTGGTAGACAAGGTTCTGGATAAA
                      ____________________________________________________________
consensus ATATTTGGAATCAAGGATGACAAGGCGGATGGGTATTTGGTAGACAAGGTTCTGGATAAA
 
. : . : . : . : . : . :
rJMSF052M15+ ACGGGCATGAAGGGCACTGGGCAAGTGGACTGTTCAGCAAGCTGCCGAGCTCTCAGTTGC
rJMSF026J11+ C
                      ____________________________________________________________
consensus ACGGGCATGAAGGGCACTGGGCAAGTGGACTGTTCAGCAAGCTGCCGAGCTCTCAGTTGC
 
. : . : . : . : . : . :
rJMSF052M15+ AGCACCAACAATAGCTTCGTCACTGGATTCAAGATTCCTTAGTGGATTGAAGGACGAGAG
rJMSF031I05+ GAGAG
rJMSF026J11+ AGCACCAACAATAGCTTCGTCACTGGATTCAAGATTCCTTAGTGGATTGAAGGACGAGAG
                      ____________________________________________________________
consensus AGCACCAACAATAGCTTCGTCACTGGATTCAAGATTCCTTAGTGGATTGAAGGACGAGAG
 
. : . : . : . : . : . :
rJMSF052M15+ GGTTCAAGCTGCCAAGGTCTTCAAATCTGCCGGGATTGGTGATATCCTTACCGACCAGGC
rJMSF031I05+ GGTTCAAGCTGCCAAGGTCTTCAAATCTGCCGGGATTGGTGATATCCTTACCGACCAGGC
rJMFF039I11+ TGCCGGGATTGGTGATATCCTTACCGACCAGGC
rJMSF026J11+ GGTTCAAGCTGCCAAGGTCTTCAAATCTGCCGGGATTGGTGATATCCTTACCGACCAGGC
                      ____________________________________________________________
consensus GGTTCAAGCTGCCAAGGTCTTCAAATCTGCCGGGATTGGTGATATCCTTACCGACCAGGC
 
. : . : . : . : . : . :
rJMSF052M15+ TGTTGATAAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
rJMSF031I05+ TGTTGATAAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
rJMFF013C14+ AAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
rJMFF039I11+ TGTTGATAAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
rJMSF026J11+ TGTTGATAAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
                      ____________________________________________________________
consensus TGTTGATAAGAAGCAGTTGATCGATGATGTGAGAAAGGCGCTGTATGCATCCAAAATATG
 
. : . : . : . : . : . :
rJMSF052M15+ TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
rJMSF031I05+ TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
rJMFF013C14+ TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
rJMFF039I11+ TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
rJMFF042M19+ TCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
rJMSF026J11+ TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
                      ____________________________________________________________
consensus TAGTTATGCCCAGGGAATGAACTTGCTTCGTGCAAAGAGCATTGAACAAGGGTGGGGCTT
 
. : . : . : . : . : . :
rJMSF052M15+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
rJMSF031I05+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
rJMFF013C14+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
rJMFF039I11+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
rJMFF042M19+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
rJMSF026J11+ GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
                      ____________________________________________________________
consensus GAAGCTCGGGGAACTGGCTAGAATTTGGAAGGGTGGTTGCATTATCCGTGCTATATTTTT
 
. : . : . : . : . : . :
rJMSF052M15+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
rJMSF031I05+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
rJMFF013C14+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
rJMFF039I11+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
rJMFF042M19+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
rJMSF026J11+ GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
                      ____________________________________________________________
consensus GGACCGTATCAAGAAAGCTTATGACAGGAACCCAGACCTCGCTAGCTTACTCGTGGATGA
 
. : . : . : . : . : . :
rJMSF052M15+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
rJMSF031I05+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
rJMFF013C14+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
rJMFF039I11+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
rJMFF042M19+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
rJMSF026J11+ AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
                      ____________________________________________________________
consensus AGAGTTCGCAAAGGAGATAATTGAACGACAATCTGCTTGGCGAAGGGTTGTATGCCTCGC
 
. : . : . : . : . : . :
rJMSF052M15+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
rJMSF031I05+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
rJMFF013C14+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
rJMFF039I11+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
rJMFF042M19+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
rJMSF005M19+ GCTTATTTTGACACTTC
rJMSF026J11+ TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
                      ____________________________________________________________
consensus TATCAACTCTGGTATTAGCGTTCCCGGGATGTCTACAAGTTTAGCTTATTTTGACACTTA
 
. : . : . : . : . : . :
rJMSF052M15+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMSF031I05+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMFF013C14+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMFF039I11+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMFF042M19+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMSF005M19+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
rJMSF026J11+ CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
                      ____________________________________________________________
consensus CAGGAGGGAAAACCTCCCTGCCAACTTAGTCCAGGCTCAAAGGGATTACTTTGGTGCCCA
 
. : . : . : . : . : . :
rJMSF052M15+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMSF031I05+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMFF013C14+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMFF039I11+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMFF042M19+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMSF005M19+ CACATACGAGAGGATNGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
rJMSF026J11+ CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
                      ____________________________________________________________
consensus CACATACGAGAGGATTGACATGCCCGGGTCTTTCCATACCGAGTGGTTCAAGATTGCCAA
 
. : . : . : . : . : . :
rJMSF052M15+ ACAGTCGAAAATTTGAATCTCTTCGGGGCCTACTTGTTGAACCGATGCTTTCATTACTCT
rJMSF031I05+ ACAGTCGAAAATTTGAATCTCTTCGGGGCCTACTTGTTGAACCGATGCTTTCATTACTCT
rJMFF013C14+ ACA
rJMFF039I11+ ACA
rJMFF042M19+ ACA
rJMSF005M19+ ACAGTCGAAAATTTGAATCTCTTCGGGGCCTACNTGTTGAACCGATGCTTTCATTACTCT
rJMSF026J11+ ACAGTCGAAAATTTGAATCTCTTCGGGGCCTACTTGTTGAACCGATGCTTTCATTACTCT
                      ____________________________________________________________
consensus ACAGTCGAAAATTTGAATCTCTTCGGGGCCTACTTGTTGAACCGATGCTTTCATTACTCT
 
. : . : . : . : . : . :
rJMSF052M15+ ACTGAATAAAGGTTTTTCTTGTGATTCAAAATACTAGATGCAGTCATATTATCATCTAG-
rJMSF031I05+ ACTGAATAAAGGTTTTTCTTGTGATTCAAAATACTAGATGCAGTCATATTATCATCTAG-
rJMSF005M19+ ACTGAATAAAGGTTTTTCTTGTGATTCAAAATACTAGANGCAGTCATATTATCATCTACG
rJMSF026J11+ ACTGAATAAAGGTTTTTCTTGTGATTCAAAATACTAGATGCAGTCATATTATCATCTAG-
                      ____________________________________________________________
consensus ACTGAATAAAGGTTTTTCTTGTGATTCAAAATACTAGATGCAGTCATATTATCATCTAG-
 
. : . : . : . : . : . :
rJMSF052M15+ -TTATGCAACATTTAGATGTAACCCTTTGAAATGTCCCGAAACATTTACGATTTAT
rJMSF031I05+ -TTATGCAACATTTAGATGTAACCCTTTGAAATGTCCCGAAACATTTACGATTTAT
rJMSF005M19+ CTTATGCAACATNTAGANGTAACCC-TCGAAATGTCCCGAA
rJMSF026J11+ -TTATGCAACATTTAGATGTAACCCTTTGAAATGTCCCGAAACATTTACGATTTATGAAG
                      ____________________________________________________________
consensus -TTATGCAACATTTAGATGTAACCCTTTGAAATGTCCCGAAACATTTACGATTTATGAAG