Previous Contig 012483:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022D18Sequence650006388 (5)pir|T47959|T479597e-11hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid785012483 (2)pir|T47959|T479599e-59hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid
JMSF026J06Sequence334006388 (5)gb:AP005803_18580910.014Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN750012483 (2)pir|T47959|T479593e-63hypothetical protein F15G16.60 - Arabidopsis thaliana>gb:ATF15G16_1548693 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF022D18+ ATCTTTAGAGTCGGGTGAATCCA
                      ____________________________________________________________
consensus ATCTTTAGAGTCGGGTGAATCCA
 
. : . : . : . : . : . :
rJMSF022D18+ GCAAAGGAGATCGGCTAAATTCCAATAAAAGCACTGAATCATTTTTTGCTGGGATTGCAA
rJMSF026J06+ AGCACTGAATCA-TTTTTGCTGGGATTGCAA
                      ____________________________________________________________
consensus GCAAAGGAGATCGGCTAAATTCCAATAAAAGCACTGAATCATTTTTTGCTGGGATTGCAA
 
. : . : . : . : . : . :
rJMSF022D18+ AGAGAAGCTTTAAATCCAAGCATGTTGTTGGTGAGGAAAGGAGCAATGTTACAGTGAATG
rJMSF026J06+ AGAGAAGCTTTAAATCCAAGCATGTTGTTGGTGAGGAAAGGAGCAATGTTACAGTGAATG
                      ____________________________________________________________
consensus AGAGAAGCTTTAAATCCAAGCATGTTGTTGGTGAGGAAAGGAGCAATGTTACAGTGAATG
 
. : . : . : . : . : . :
rJMSF022D18+ GGCATCTTATACCGGACCAGCTTTTTAAAAAAGCTGAAAGGGTAGCTGG--AAATAAACC
rJMSF026J06+ GGCATCTTATACCGGACCAGCTTTTTAAAAAAGCTGAAAGGGTAGCTGGAAAAATAAACC
                      ____________________________________________________________
consensus GGCATCTTATACCGGACCAGCTTTTTAAAAAAGCTGAAAGGGTAGCTGGAAAAATAAACC
 
. : . : . : . : . : . :
rJMSF022D18+ CTGGACATTACTGGTATGACTTCCGAGCTGGATTTTGGGGAGTGATGGGAGGTCCTTGCC
rJMSF026J06+ CTGGACATTACTGGTATGACTTCCGAGCTGGATTTTGGGGAGTGATGGGAGGTCCTTGCC
                      ____________________________________________________________
consensus CTGGACATTACTGGTATGACTTCCGAGCTGGATTTTGGGGAGTGATGGGAGGTCCTTGCC
 
. : . : . : . : . : . :
rJMSF022D18+ TGGGCATAGTTCCGCCATTTATTGAAGAATTTAACTATCCCATGCCTGAAAATTGTGCTG
rJMSF026J06+ TGGGCATAGTTCCGCCATTTATTGAAGAATTTAACTATCCCATGCCTGAAAATTGTGCTG
                      ____________________________________________________________
consensus TGGGCATAGTTCCGCCATTTATTGAAGAATTTAACTATCCCATGCCTGAAAATTGTGCTG
 
. : . : . : . : . : . :
rJMSF022D18+ GTGGAAACACTGGTGTGTTTGTGAATGGGAGAGAGCTTCATAACAAAGATCTGCAATTAC
rJMSF026J06+ GTGGAAACACTGGTGTGTTTGTGAATGGGAGAGAGCTTCATAACAAAGATCTGCAATTAC
                      ____________________________________________________________
consensus GTGGAAACACTGGTGTGTTTGTGAATGGGAGAGAGCTTCATAACAAAGATCTGCAATTAC
 
. : . : . : . : . : . :
rJMSF022D18+ TATGCAGCAGAGGGCTCTCATCTGAGAGAGATAGATCTTATATCGTTGAAATTTCGGGCA
rJMSF026J06+ TATGCAGCAGAGGGCTCTCATCTGAGAGAGATAGATCTTATATCGTTGAAATTTCGGGCA
                      ____________________________________________________________
consensus TATGCAGCAGAGGGCTCTCATCTGAGAGAGATAGATCTTATATCGTTGAAATTTCGGGCA
 
. : . : . : . : . : . :
rJMSF022D18+ GAGTCCTTGACGAGGATACTGGTGAAGAGCTAGAGAGCCTGGGCAAACTCGCTCCAACAG
rJMSF026J06+ GAGTCCTTGACGAGGATACTGGTGAAGAGCTAGAGAGCCTGGGCAAACTCGCTCCAACAG
                      ____________________________________________________________
consensus GAGTCCTTGACGAGGATACTGGTGAAGAGCTAGAGAGCCTGGGCAAACTCGCTCCAACAG
 
. : . : . : . : . : . :
rJMSF022D18+ TTGAGAGAATGAAGCGAGGATTTGGCATGAAAGTTCCAAAGAGAGCAGCATGATTATGTC
rJMSF026J06+ TTGAGAGAATGAAGCGAGGATTTGGCATGAAAGTTCCAAAGAGAGCAGCATGATTATGTC
                      ____________________________________________________________
consensus TTGAGAGAATGAAGCGAGGATTTGGCATGAAAGTTCCAAAGAGAGCAGCATGATTATGTC
 
. : . : . : . : . : . :
rJMSF022D18+ TATGCAGAAACAACGTTGATGTTTCATTGTTCTACAGAAGATCTTGTCGTCTTGGTCCAT
rJMSF026J06+ TATGCAGAAACAACGTTGATGTTTCATTGTTCTACAGAAGATCTTGTCGTCTTGGTCCAT
                      ____________________________________________________________
consensus TATGCAGAAACAACGTTGATGTTTCATTGTTCTACAGAAGATCTTGTCGTCTTGGTCCAT
 
. : . : . : . : . : . :
rJMSF022D18+ AAATCTTGCAGGCCTAAAATGGAATGGGGAATCTATATGAGCTTTGAGTCTAGCATGGCA
rJMSF026J06+ AAATCTTGCAGGCCTAAAATGGAATGGGGAATCTATATGAGCTTTGAGTCTAGCATGGCA
                      ____________________________________________________________
consensus AAATCTTGCAGGCCTAAAATGGAATGGGGAATCTATATGAGCTTTGAGTCTAGCATGGCA
 
. : . : . : . : . : . :
rJMSF022D18+ TCATATATGTAAAATCTAGCTTGCTTTGGTTGTACCTAATCTGCATTTTAGTGGTACATA
rJMSF026J06+ TCATATATGTAAAATCTAGCTTGCTTTGGTTGTACCTAATCTGCATTTTAGTGGTACATA
                      ____________________________________________________________
consensus TCATATATGTAAAATCTAGCTTGCTTTGGTTGTACCTAATCTGCATTTTAGTGGTACATA
 
. : . : . : . : . : . :
rJMSF022D18+ TAATAGTGATTCATGTGCTTGCTGCACCCTCTATGGCAGACATT
rJMSF026J06+ TAATAGTGATTCATGTGCTTGCTGCACCCTCTATGGCAGACATTTCCCATTGTGATTCTT
                      ____________________________________________________________
consensus TAATAGTGATTCATGTGCTTGCTGCACCCTCTATGGCAGACATTTCCCATTGTGATTCTT