Previous Contig 012476:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026H05Sequence579012476 (2)gb:AY087039_15720753e-51Arabidopsis thaliana clone 30880 mRNA, complete sequence.692012476 (2)gb:AY087039_15720751e-61Arabidopsis thaliana clone 30880 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026H05- GTGGAGAAGAATGGCGGCAGTTCTACTGAACC
rJMSF026H05+ GTGGAGAAGAATGGCGGCAGTTCTACTGAACC
                      ____________________________________________________________
consensus GTGGAGAAGAATGGCGGCAGTTCTACTGAACC
 
. : . : . : . : . : . :
JMSF026H05- AGCTTCAACCAACCACTCTCAAGCATTCCAAGCAACCGCAACCATCTCTGTGCGCCACCC
rJMSF026H05+ AGCTTCAACCAACCACTCTCAAGCATTCCAAGCAACCGCAACCATCTCTGTGCGCCACCC
                      ____________________________________________________________
consensus AGCTTCAACCAACCACTCTCAAGCATTCCAAGCAACCGCAACCATCTCTGTGCGCCACCC
 
. : . : . : . : . : . :
JMSF026H05- CGCAACGGTCGGCAGCCGTGAGAGTGAACGCAACTTCCGGCAACGCCCAGCAGCTTATAC
rJMSF026H05+ CGCAACGGTCGGCAGCCGTGAGAGTGAACGCAACTTCCGGCAACGCCCAGCAGCTTATAC
                      ____________________________________________________________
consensus CGCAACGGTCGGCAGCCGTGAGAGTGAACGCAACTTCCGGCAACGCCCAGCAGCTTATAC
 
. : . : . : . : . : . :
JMSF026H05- AGTCCGGAACCGTACGCCCAATACCGCCCAAAGATGCCGCCACGGCCGTGGACTCCGAAG
rJMSF026H05+ AGTCCGGAACCGTACGCCCAATACCGCCCAAAGATGCCGCCACGGCCGTGGACTCCGAAG
                      ____________________________________________________________
consensus AGTCCGGAACCGTACGCCCAATACCGCCCAAAGATGCCGCCACGGCCGTGGACTCCGAAG
 
. : . : . : . : . : . :
JMSF026H05- GCTACATCTTGCTGGATATCCGGCCCGAATGGGAAAGAGCCAAGGCCCGAGTTTCGGGCT
rJMSF026H05+ GCTACATCTTGCTGGATATCCGGCCCGAATGGGAAAGAGCCAAGGCCCGAGTTTCGGGCT
                      ____________________________________________________________
consensus GCTACATCTTGCTGGATATCCGGCCCGAATGGGAAAGAGCCAAGGCCCGAGTTTCGGGCT
 
. : . : . : . : . : . :
JMSF026H05- CTCGCCACATTCCGCTGTTCGTCAAGGACCCGGATAATAGCCCCTTGGGTCTGCTCAAGA
rJMSF026H05+ CTCGCCACATTCCGCTGTTCGTCAAGGACCCGGATAATAGCCCCTTGGGTCTGCTCAAGA
                      ____________________________________________________________
consensus CTCGCCACATTCCGCTGTTCGTCAAGGACCCGGATAATAGCCCCTTGGGTCTGCTCAAGA
 
. : . : . : . : . : . :
JMSF026H05- AATGGGTGCATTTCGGTTATATTGGGCTGTGGACGGGCCAGAATATGACCATGTTCAACC
rJMSF026H05+ AATGGGTGCATTTCGGTTATATTGGGCTGTGGACGGGCCAGAATATGACCATGTTCAACC
                      ____________________________________________________________
consensus AATGGGTGCATTTCGGTTATATTGGGCTGTGGACGGGCCAGAATATGACCATGTTCAACC
 
. : . : . : . : . : . :
JMSF026H05- CCGAGTTTTTAAGACAAGTAGAGACACAGATTCCCGACAAGGATTCCAAGATCCTCGTAG
rJMSF026H05+ CCGAGTTTTTAAGACAAGTAGAGACACAGATTCCCGACAAGGATTCCAAGATCCTCGTAG
                      ____________________________________________________________
consensus CCGAGTTTTTAAGACAAGTAGAGACACAGATTCCCGACAAGGATTCCAAGATCCTCGTAG
 
. : . : . : . : . : . :
JMSF026H05- CTTGTGGTGAAGGATTGAGGTCTATGATGGCTGTTTCAAAGTTGCATAGAAGTGGATACG
rJMSF026H05+ CTTGTGGTGAAGGATTGAGGTCTATGATGGCTGTTTCAAAGTTGCATAGAAGTGGATACG
                      ____________________________________________________________
consensus CTTGTGGTGAAGGATTGAGGTCTATGATGGCTGTTTCAAAGTTGCATAGAAGTGGATACG
 
. : . : . : . : . : . :
JMSF026H05- CAAACCTGGCATGGCTGGCCGGAGGGTATAAATCCGCCGAAGATAGCCATTTTCCGGCAG
rJMSF026H05+ CAAACCTGGCATGGCTGGCCGGAGGGTATAAATCCGCCGAAGATAGCCATTTTCCGGCAG
                      ____________________________________________________________
consensus CAAACCTGGCATGGCTGGCCGGAGGGTATAAATCCGCCGAAGATAGCCATTTTCCGGCAG
 
. : . : . : . : . : . :
JMSF026H05- TCGAAGG
rJMSF026H05+ TCGAAGGGCCGGAGAAGTTGCAGTATGCCACCGTCGGAGGTGCATCGTATTACTTCCTTC
                      ____________________________________________________________
consensus TCGAAGGGCCGGAGAAGTTGCAGTATGCCACCGTCGGAGGTGCATCGTATTACTTCCTTC
 
. : . : . : . : . : . :
rJMSF026H05+ AATTGCTTATTTTACTTAAAGCTGTGGGGAACAAAGATTGATCCAATAATGACTTTTTTG
                      ____________________________________________________________
consensus AATTGCTTATTTTACTTAAAGCTGTGGGGAACAAAGATTGATCCAATAATGACTTTTTTG