Previous Contig 012467:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026E07Sequence627012467 (2)pir|T06029|T060290.001hypothetical protein T28I19.100 - Arabidopsis thaliana>gb:ATCHRIV88_1547736 Arab768012467 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026E07- GCTGGT
                      ____________________________________________________________
consensus GCTGGT
 
. : . : . : . : . : . :
JMSF026E07- TTACCAAGTGAAACAGTCCCACGAGAAGAAGAAACAGTTTGATGGGAACGAGTCGAGTTT
                      ____________________________________________________________
consensus TTACCAAGTGAAACAGTCCCACGAGAAGAAGAAACAGTTTGATGGGAACGAGTCGAGTTT
 
. : . : . : . : . : . :
JMSF026E07- GTCTCAGAAAACGGGAAGCAGCAGCGATGGAGGTCCAAATTTAGGACGAAAATACCTCCC
                      ____________________________________________________________
consensus GTCTCAGAAAACGGGAAGCAGCAGCGATGGAGGTCCAAATTTAGGACGAAAATACCTCCC
 
. : . : . : . : . : . :
JMSF026E07- CGATTCGAAGGGAATGGCTAATAGTGGCACGGAAGATAACAACCTGGAAGAAGATGGTAG
                      ____________________________________________________________
consensus CGATTCGAAGGGAATGGCTAATAGTGGCACGGAAGATAACAACCTGGAAGAAGATGGTAG
 
. : . : . : . : . : . :
JMSF026E07- AGGAGGTGGAGATGACGATTTAGAAGAACACGATCGGGAGAAAAATGATGGCGAGGTTGA
                      ____________________________________________________________
consensus AGGAGGTGGAGATGACGATTTAGAAGAACACGATCGGGAGAAAAATGATGGCGAGGTTGA
 
. : . : . : . : . : . :
JMSF026E07- ACGAGAAGACAAAGCGGTGGGTGATGATGAGAAGGAGAGTGAGGAGCGAGATTCTGATGA
                      ____________________________________________________________
consensus ACGAGAAGACAAAGCGGTGGGTGATGATGAGAAGGAGAGTGAGGAGCGAGATTCTGATGA
 
. : . : . : . : . : . :
JMSF026E07- TAATAACGGGGACGAGATTTCCGAGGACAATGAAAACGATGAGGATTCGGGGAGTAAGCA
                      ____________________________________________________________
consensus TAATAACGGGGACGAGATTTCCGAGGACAATGAAAACGATGAGGATTCGGGGAGTAAGCA
 
. : . : . : . : . : . :
JMSF026E07- CGAGGCACAAGAGGTACTATATAAAGCAGACGATGCTTCAAGTGCAGTAACTCATGATAG
                      ____________________________________________________________
consensus CGAGGCACAAGAGGTACTATATAAAGCAGACGATGCTTCAAGTGCAGTAACTCATGATAG
 
. : . : . : . : . : . :
JMSF026E07- CATCGAGGAAGTAAGCGAGAACGCTGAGGTAAATGTTCTGGAACAGGCAGGAGTAGTCAA
                      ____________________________________________________________
consensus CATCGAGGAAGTAAGCGAGAACGCTGAGGTAAATGTTCTGGAACAGGCAGGAGTAGTCAA
 
. : . : . : . : . : . :
JMSF026E07- TAACGACAACAAAATTAGCGATGGTCAAGACACAATAGGCCACGAAGAATCTGAGCATGT
rJMSF026E07+ AATTAGCGATGGTCAAGACACNATAGGCCACGAAGAATCTGAGCATGT
                      ____________________________________________________________
consensus TAACGACAACAAAATTAGCGATGGTCAAGACACAATAGGCCACGAAGAATCTGAGCATGT
 
. : . : . : . : . : . :
JMSF026E07- CTCGGAAGGGTTAAATGGTCATCCCGTGGAAAGAAATTTGACCGAGAAAACCGGGGAGGC
rJMSF026E07+ CTCGGAAGGGTTAAATGGTCATCCCGTGGAAAGAAATTTGACCGAGAAAACCGGGGAGGC
                      ____________________________________________________________
consensus CTCGGAAGGGTTAAATGGTCATCCCGTGGAAAGAAATTTGACCGAGAAAACCGGGGAGGC
 
. : . : . : . : . : . :
JMSF026E07- AAATGATTTATCCATCC
rJMSF026E07+ AAATGATTTATCCATCCAGAAAAGAGATGATTCTGCTTTGGTTGTCAATAATAGTCTCTC
                      ____________________________________________________________
consensus AAATGATTTATCCATCCAGAAAAGAGATGATTCTGCTTTGGTTGTCAATAATAGTCTCTC
 
. : . : . : . : . : . :
rJMSF026E07+ TGAGTCTAATTTAACAACCTTAAAAAACGGGGATGCAGAATCAACCGAATCAGATTCCTC
                      ____________________________________________________________
consensus TGAGTCTAATTTAACAACCTTAAAAAACGGGGATGCAGAATCAACCGAATCAGATTCCTC
 
. : . : . : . : . : . :
rJMSF026E07+ AGCTGAATCTAATCACTCGAAATCTTCTGTCTCGGAGAAGGTCATACATGGTCATCCTCG
                      ____________________________________________________________
consensus AGCTGAATCTAATCACTCGAAATCTTCTGTCTCGGAGAAGGTCATACATGGTCATCCTCG
 
. : . : . : . : . : . :
rJMSF026E07+ GTTCACAACCGAGGATGACCGATGGTCCACGACAATCGATACTGATGCTGAGAAATCTCG
                      ____________________________________________________________
consensus GTTCACAACCGAGGATGACCGATGGTCCACGACAATCGATACTGATGCTGAGAAATCTCG
 
. : . : . : . : . : . :
rJMSF026E07+ AACAGTTGATGAAACAGGCAGAGCAGACGAAGAGTTCGAGTCCTTCAATACTGAGAATAT
                      ____________________________________________________________
consensus AACAGTTGATGAAACAGGCAGAGCAGACGAAGAGTTCGAGTCCTTCAATACTGAGAATAT
 
. : . : . : . : . : . :
rJMSF026E07+ AGGTGAAATCGAAGATCTGATTGACTCCTCCGATTCGTCGTTTTCCCTGGACGAGAAAGA
                      ____________________________________________________________
consensus AGGTGAAATCGAAGATCTGATTGACTCCTCCGATTCGTCGTTTTCCCTGGACGAGAAAGA
 
. : . : . : . : . : . :
rJMSF026E07+ TGTACGCACTGATCTCGAAACCCTTCCGGAAATACAAACCGAAGGAAGTAACACAGAAGA
                      ____________________________________________________________
consensus TGTACGCACTGATCTCGAAACCCTTCCGGAAATACAAACCGAAGGAAGTAACACAGAAGA
 
. : . : . : . : . : . :
rJMSF026E07+ TCCTGCAGCCAAATGAAACTGTATAATATACCATTTCTACTGCAGCTCAAATTATTATTA
                      ____________________________________________________________
consensus TCCTGCAGCCAAATGAAACTGTATAATATACCATTTCTACTGCAGCTCAAATTATTATTA
 
. : . : . : . : . : . :
rJMSF026E07+ TAATTCCTTCTTCTTTTTCTTCATTTTTTGTTTAATTCACTATTTAGTTTATGAATCTGC
                      ____________________________________________________________
consensus TAATTCCTTCTTCTTTTTCTTCATTTTTTGTTTAATTCACTATTTAGTTTATGAATCTGC
 
. : . : . : . : . : . :
rJMSF026E07+ AAAAAGTTCTATGAATGCTTTTGAATATGAGAAGTATGGATAGAGAAACAGCTTGTACAA
                      ____________________________________________________________
consensus AAAAAGTTCTATGAATGCTTTTGAATATGAGAAGTATGGATAGAGAAACAGCTTGTACAA
 
. : . : . : . : . : . :
rJMSF026E07+ CTTTGTGGGCAAAATGTTGGCAAAGTTGGGTTCTGTATAATCAACTCTTGTATATCAAAT
                      ____________________________________________________________
consensus CTTTGTGGGCAAAATGTTGGCAAAGTTGGGTTCTGTATAATCAACTCTTGTATATCAAAT