Previous Contig 012465:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026D24Sequence656012465 (2)gb:AP001310_18211436e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO22.660012465 (2)gb:AP001310_18211435e-68Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MUO22.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026D24- GCGAACCATTTATTATACA
                      ____________________________________________________________
consensus GCGAACCATTTATTATACA
 
. : . : . : . : . : . :
JMSF026D24- GCTCACTCAGCTCACCGTGGTCCATTTCTCTTCTCAGGAAAAATGGGCGGCTGTGTTTCA
                      ____________________________________________________________
consensus GCTCACTCAGCTCACCGTGGTCCATTTCTCTTCTCAGGAAAAATGGGCGGCTGTGTTTCA
 
. : . : . : . : . : . :
JMSF026D24- AACCCAACCAGAAGATCAAATCACACAGAGTGCCCTTCCCAAAGTGTCGAAGGTTTCGTA
                      ____________________________________________________________
consensus AACCCAACCAGAAGATCAAATCACACAGAGTGCCCTTCCCAAAGTGTCGAAGGTTTCGTA
 
. : . : . : . : . : . :
JMSF026D24- GGAAGAGGCCTTGCAGTGTGTCTGTTGCACCAATGGAACAGTTTTCTGGTGTGGGGAATT
                      ____________________________________________________________
consensus GGAAGAGGCCTTGCAGTGTGTCTGTTGCACCAATGGAACAGTTTTCTGGTGTGGGGAATT
 
. : . : . : . : . : . :
JMSF026D24- ACGGGAGAGATTTCGATGCAGATGAGTTTATACTGGGTTTGCTTGAGACCCAAAATTCCC
                      ____________________________________________________________
consensus ACGGGAGAGATTTCGATGCAGATGAGTTTATACTGGGTTTGCTTGAGACCCAAAATTCCC
 
. : . : . : . : . : . :
JMSF026D24- TAGACTCCTTTTGAGATTGAATTTTGCTTGTTCTATTATTCCAAATAACACTCCCTTTTA
                      ____________________________________________________________
consensus TAGACTCCTTTTGAGATTGAATTTTGCTTGTTCTATTATTCCAAATAACACTCCCTTTTA
 
. : . : . : . : . : . :
JMSF026D24- TAGGGTTGATTACAAAGAAGATATCTCACATTGCTCAGCATCTTCAATTGCCTACTGTAG
rJMSF026D24+ TAGGGTTGATTACAAAGAAGATATCTCACATTGCTCAGCATCTTCAATTGCCTACTGTAG
                      ____________________________________________________________
consensus TAGGGTTGATTACAAAGAAGATATCTCACATTGCTCAGCATCTTCAATTGCCTACTGTAG
 
. : . : . : . : . : . :
JMSF026D24- AGCCACACGATAAAGTTCCACCGCTTCTGATCATTAATATACAGCTACCAACATATCCCG
rJMSF026D24+ AGCCACACGATAAAGTTCCACCGCTTCTGATCATTAATATACAGCTACCAACATATCCCG
                      ____________________________________________________________
consensus AGCCACACGATAAAGTTCCACCGCTTCTGATCATTAATATACAGCTACCAACATATCCCG
 
. : . : . : . : . : . :
JMSF026D24- CTTCCCTGTTCCTTGGAGACGGGGATGGGGAAGGAATGAGCCTCGTCTTGTATTTCCAAT
rJMSF026D24+ CTTCCCTGTTCCTTGGAGACGGGGATGGGGAAGGAATGAGCCTCGTCTTGTATTTCCAAT
                      ____________________________________________________________
consensus CTTCCCTGTTCCTTGGAGACGGGGATGGGGAAGGAATGAGCCTCGTCTTGTATTTCCAAT
 
. : . : . : . : . : . :
JMSF026D24- TATCAGAGAACTTCGAGAAAGAGACTTCGCCACAATTTCAAGACAGCATAAAGAGACTTG
rJMSF026D24+ TATCAGAGAACTTCGAGAAAGAGACTTCGCCACAATTTCAAGACAGCATAAAGAGACTTG
                      ____________________________________________________________
consensus TATCAGAGAACTTCGAGAAAGAGACTTCGCCACAATTTCAAGACAGCATAAAGAGACTTG
 
. : . : . : . : . : . :
JMSF026D24- TGATGGATGAGGTAGAAACCGTCAAGGGTTTTGCAAAAGAATCAGCGGTGCCATACCGGG
rJMSF026D24+ TGATGGATGAGGTAGAAACCGTCAAGGGTTTTGCAAAAGAATCAGCGGTGCCATACCGGG
                      ____________________________________________________________
consensus TGATGGATGAGGTAGAAACCGTCAAGGGTTTTGCAAAAGAATCAGCGGTGCCATACCGGG
 
. : . : . : . : . : . :
JMSF026D24- AGAGACTAAAAATTTTGGTTGGCGTCGTGAATCA
rJMSF026D24+ AGAGACTAAAAATTTTGGTTGGCGTCGTGAATCATGCAGAGAAGAAGCTTTTGCGTGCCT
                      ____________________________________________________________
consensus AGAGACTAAAAATTTTGGTTGGCGTCGTGAATCATGCAGAGAAGAAGCTTTTGCGTGCCT
 
. : . : . : . : . : . :
rJMSF026D24+ ACAGGCTACAACAATAAGCCAGTACTTTCACGTCCCCAGCACGCTTTCTATAAGGGTCCA
                      ____________________________________________________________
consensus ACAGGCTACAACAATAAGCCAGTACTTTCACGTCCCCAGCACGCTTTCTATAAGGGTCCA
 
. : . : . : . : . : . :
rJMSF026D24+ AAACTATTTTGAAATCGACCTGGATGTTCATCATTTCAGCTACATTTCTAGGAAAGGGCT
                      ____________________________________________________________
consensus AAACTATTTTGAAATCGACCTGGATGTTCATCATTTCAGCTACATTTCTAGGAAAGGGCT
 
. : . : . : . : . : . :
rJMSF026D24+ TGATGCATTCCGGGAGAGGTTGAAACATGGGATACTTGACTTAGGATTAACGATCCAGGC
                      ____________________________________________________________
consensus TGATGCATTCCGGGAGAGGTTGAAACATGGGATACTTGACTTAGGATTAACGATCCAGGC
 
. : . : . : . : . : . :
rJMSF026D24+ TCAGAAGGCGGAGGAACTGCCAGAGAAAGTTGTGTGCAACATTCGACTGAACAAGATTGA
                      ____________________________________________________________
consensus TCAGAAGGCGGAGGAACTGCCAGAGAAAGTTGTGTGCAACATTCGACTGAACAAGATTGA
 
. : . : . : . : . : . :
rJMSF026D24+ TTTTGTAAATCATGGGCAGATACCTCAATTTGTAATACCTGTATAACTTCAACTCAGATC
                      ____________________________________________________________
consensus TTTTGTAAATCATGGGCAGATACCTCAATTTGTAATACCTGTATAACTTCAACTCAGATC