Previous Contig 012463:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026D21Sequence623012463 (2)gb:AY140068_15825081e-23Arabidopsis thaliana unknown protein (At1g20460) mRNA, complete cds.>gb:BT002145662012463 (2)gb:AY086332_15713825e-20Arabidopsis thaliana clone 24004 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF026D21- GC
rJMSF026D21+ GC
                      ____________________________________________________________
consensus GC
 
. : . : . : . : . : . :
JMSF026D21- CTTTTCCTTCTCGTTTCTCCAAAATCACTTCAAATTCATCTGTTGCTTCATCAGCCATCG
rJMSF026D21+ CTTTTCCTTCTCGTTTCTCCAAAATCACTTCAAATTCATCTGTTGCTTCATCAGCCATCG
                      ____________________________________________________________
consensus CTTTTCCTTCTCGTTTCTCCAAAATCACTTCAAATTCATCTGTTGCTTCATCAGCCATCG
 
. : . : . : . : . : . :
JMSF026D21- TCTCGTCGCCGGCGGTTCGGATGCTCCGATTCTTTATGCCAAATCGGTACAACCTGGGGA
rJMSF026D21+ TCTCGTCGCCGGCGGTTCGGATGCTCCGATTCTTTATGCCAAATCGGTACAACCTGGGGA
                      ____________________________________________________________
consensus TCTCGTCGCCGGCGGTTCGGATGCTCCGATTCTTTATGCCAAATCGGTACAACCTGGGGA
 
. : . : . : . : . : . :
JMSF026D21- AGCGTATAGATATAATATATACATAGAGGGAGAGAGAGATAGGGATTAGAGAGGGAGTGG
rJMSF026D21+ AGCGTATAGATATAATATATACATAGAGGGAGAGAGAGATAGGGATTAGAGAGGGAGTGG
                      ____________________________________________________________
consensus AGCGTATAGATATAATATATACATAGAGGGAGAGAGAGATAGGGATTAGAGAGGGAGTGG
 
. : . : . : . : . : . :
JMSF026D21- GGTGGAGCGGCCATGATAACTCGATCGAATTTGGCGGAACAGCTGAGGGAATATCAGATT
rJMSF026D21+ GGTGGAGCGGCCATGATAACTCGATCGAATTTGGCGGAACAGCTGAGGGAATATCAGATT
                      ____________________________________________________________
consensus GGTGGAGCGGCCATGATAACTCGATCGAATTTGGCGGAACAGCTGAGGGAATATCAGATT
 
. : . : . : . : . : . :
JMSF026D21- CGATCGAAACATGATTGGGCTTCCGTCTCTTTCTTCTCCTCTACCTCCAATCTCACTACT
rJMSF026D21+ CGATCGAAACATGATTGGGCTTCCGTCTCTTTCTTCTCCTCTACCTCCAATCTCACTACT
                      ____________________________________________________________
consensus CGATCGAAACATGATTGGGCTTCCGTCTCTTTCTTCTCCTCTACCTCCAATCTCACTACT
 
. : . : . : . : . : . :
JMSF026D21- TCCAGGGTGGATGTCGTCATCTTTGTAATATGGGAACTTGTCATTTTTGCATGCGTTGTT
rJMSF026D21+ TCCAGGGTGGATGTCGTCATCTTTGTAATATGGGAACTTGTCATTTTTGCATGCGTTGTT
                      ____________________________________________________________
consensus TCCAGGGTGGATGTCGTCATCTTTGTAATATGGGAACTTGTCATTTTTGCATGCGTTGTT
 
. : . : . : . : . : . :
JMSF026D21- TTCACCTGTGTTTCACTCTATTTAAGCCATCTAAGGCTTGCTTTGATCTTAATATGCTTT
rJMSF026D21+ TTCACCTGTGTTTCACTCTATTTAAGCCATCTAAGGCTTGCTTTGATCTTAATATGCTTT
                      ____________________________________________________________
consensus TTCACCTGTGTTTCACTCTATTTAAGCCATCTAAGGCTTGCTTTGATCTTAATATGCTTT
 
. : . : . : . : . : . :
JMSF026D21- ACATTTCTGCTGTTTATATGCATGAGAATTACAAAGCAGATTANGCTTGCCCGGAAAAAG
rJMSF026D21+ ACATTTCTGCTGTTTATATGCATGAGAATTACAAAGCAGATTAGGCTTGCCCGGAAAAAG
                      ____________________________________________________________
consensus ACATTTCTGCTGTTTATATGCATGAGAATTACAAAGCAGATTAGGCTTGCCCGGAAAAAG
 
. : . : . : . : . : . :
JMSF026D21- AAGCGAAGGATGCTACTACCATTATCAATGTANAATTCTAGGGAGGGAATATTCTTTAAC
rJMSF026D21+ AAGCGAAGGATGCTACTACCATTATCAATGTAGAATTCTAGGGAGGGAATATTCTTTAAC
                      ____________________________________________________________
consensus AAGCGAAGGATGCTACTACCATTATCAATGTAGAATTCTAGGGAGGGAATATTCTTTAAC
 
. : . : . : . : . : . :
JMSF026D21- AATGTACCCCTACTAGGGTTATGTAAATGGTGAGAAATCTTGGCCACTGCTTCTGCCAAC
rJMSF026D21+ AATGTACCCCTACTAGGGTTATGTAAATGGTGAGAAATCTTGGCCACTGCTTCTGCCAAC
                      ____________________________________________________________
consensus AATGTACCCCTACTAGGGTTATGTAAATGGTGAGAAATCTTGGCCACTGCTTCTGCCAAC
 
. : . : . : . : . : . :
JMSF026D21- CTTTTGTTTTTTTTTCCTGGT
rJMSF026D21+ CTTTTGTTTTTTTTTCCTGGTTTCTGTGTATTTTGCTTGAGACCAAGCTGATGGAAGGAC
                      ____________________________________________________________
consensus CTTTTGTTTTTTTTTCCTGGTTTCTGTGTATTTTGCTTGAGACCAAGCTGATGGAAGGAC