Previous Contig 012462:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017B10Sequence558004831 (4)gb:LAL344108_16838922e-75Lupinus albus mRNA for ATP citrate lyase b-subunit (aclb gene).811012462 (4)gb:AY081273_1568619e-103Arabidopsis thaliana similar to ATP-citrate-lyase (At1g60810) mRNA, complete cds
JMFF027P06Sequence457004831 (4)gb:AY087536_15725663e-56Arabidopsis thaliana clone 36439 mRNA, complete sequence.795012462 (4)gb:AY081273_1568619e-100Arabidopsis thaliana similar to ATP-citrate-lyase (At1g60810) mRNA, complete cds
JMFN006C07Sequence561012462 (4)pir|F86227|F862274e-59hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889949 Arabid
JMSF026D16Sequence695004831 (4)gb:AY087536_15725665e-96Arabidopsis thaliana clone 36439 mRNA, complete sequence.776012462 (4)gb:AY081273_15686197e-81Arabidopsis thaliana similar to ATP-citrate-lyase (At1g60810) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017B10+ GGACATGAGGGGGGA
                      ____________________________________________________________
consensus GGACATGAGGGGGGA
 
. : . : . : . : . : . :
rJMFF027P06+ ACTCGATGACACTGCTGCTTTTAAGAACTTTAAGAAGTGGGGAGATATTGAATTCCCGTT
rJMFF017B10+ ACTCGATGACACTGCTGCTTTTAAGAACTTTAAGAAGTGGGGAGATATTGAATTCCCGTT
                      ____________________________________________________________
consensus ACTCGATGACACTGCTGCTTTTAAGAACTTTAAGAAGTGGGGAGATATTGAATTCCCGTT
 
. : . : . : . : . : . :
rJMFF027P06+ GCCATTTGGAAGGGTCATGAGCGCTACAGAAAGCTTTATCCATGGGCTGGATGAGAAGAC
rJMFF017B10+ GCCATTTGGAAGGGTCATGAGCGCTACAGAAAGCTTTATCCATGGGCTGGATGAGAAGAC
rJMSF026D16+ GGAAGGGTCATGAGCGCTACAGAAAGCTTTATCCATGGGCTGGATGAGAAGAC
                      ____________________________________________________________
consensus GCCATTTGGAAGGGTCATGAGCGCTACAGAAAGCTTTATCCATGGGCTGGATGAGAAGAC
 
. : . : . : . : . : . :
rJMFF027P06+ AAGTGCATCTTTGAAGTTCACGGTCTTGAACCCAAAGGGACGAATCTGGACCATGGTGGC
rJMFF017B10+ AAGTGCATCTTTGAAGTTCACGGTCTTGAACCCAAAGGGACGAATCTGGACCATGGTGGC
rJMSF026D16+ AAGTGCATCTTTGAAGTTCACGGTCTTGAACCCAAAGGGACGAATCTGGACCATGGTGGC
                      ____________________________________________________________
consensus AAGTGCATCTTTGAAGTTCACGGTCTTGAACCCAAAGGGACGAATCTGGACCATGGTGGC
 
. : . : . : . : . : . :
rJMFF027P06+ TGGTGGAGGTGCCAGTGTCATCTATGCCGATACTGTTGGAGACCTTGGATATGCATCTGA
JMFN006C07- CCGATACTGTTGGAGACCTTGGATATGCATCTGA
rJMFF017B10+ TGGTGGAGGTGCCAGTGTCATCTATGCCGATACTGTTGGAGACCTTGGATATGCATCTGA
rJMSF026D16+ TGGTGGAGGTGCCAGTGTCATCTATGCCGATACTGTTGGAGACCTTGGATATGCATCT-A
                      ____________________________________________________________
consensus TGGTGGAGGTGCCAGTGTCATCTATGCCGATACTGTTGGAGACCTTGGATATGCATCTGA
 
. : . : . : . : . : . :
rJMFF027P06+ ACTCGGGAACTATGCTGAATATAGCGGGGCTCCTAATGAAGAAGAGGTCCTGCAGTATGC
JMFN006C07- ACTCGGGAACTATGCTGAATATAGCGGGGCTCCTAATGAAGAAGAGGTCCTGCAGTATGC
rJMFF017B10+ ACTCGGGAACTATGCTGAATATAGCGGGGCTCCTAATGAAGAAGAGGTCCTGCAGTATGC
rJMSF026D16+ ACTCGGGAACTATGCTGAATATAGCGGGGCTCCTAATGAAGAAGAGGTCCTGCAGTATGC
                      ____________________________________________________________
consensus ACTCGGGAACTATGCTGAATATAGCGGGGCTCCTAATGAAGAAGAGGTCCTGCAGTATGC
 
. : . : . : . : . : . :
rJMFF027P06+ CAGAGTCGTTATTGATTGTGCAACTGCAGACCCTGATGGTCGTAAAAGAGCTCTCGTGAT
JMFN006C07- CAGAGTCGTTATTGATTGTGCAACTGCAGACCCTGATGGTCGTAAAAGAGCTCTCGTGAT
rJMFF017B10+ CAGAGTCGTTATTGATTGTGCAACTGCAGACCCTGATGGTCGTAAAAGAGCTCTCGTGAT
rJMSF026D16+ CAGAGTCGTTATTGATTGTGCAACTGCAGACCCTGATGGTCGTAAAAGAGCTCTCGTGAT
                      ____________________________________________________________
consensus CAGAGTCGTTATTGATTGTGCAACTGCAGACCCTGATGGTCGTAAAAGAGCTCTCGTGAT
 
. : . : . : . : . : . :
rJMFF027P06+ TGGTGGTGGTATAGCAAACTTTACTGACGTTGCTGCTACATTTAATGGCATAATCCGAGC
JMFN006C07- TGGTGGTGGTATAGCAAACTTTACTGACGTTGCTGCTACATTTAATGGCATAATCCGAGC
rJMFF017B10+ TGGTGGTGGTATAGCAAACTTTACTGACGTTGCTGCTACATTTAATGGCATAATCCGAGC
rJMSF026D16+ TGGTGGTGGTATAGCAAACTTTACTGACGTTGCTGCTACATTTAATGGCATAATCCGAGC
                      ____________________________________________________________
consensus TGGTGGTGGTATAGCAAACTTTACTGACGTTGCTGCTACATTTAATGGCATAATCCGAGC
 
. : . : . : . : . : . :
rJMFF027P06+ TTTGAAGGAGAAGGAATCGAAGCTCAAGGCTGCTAGAATGAGTATCTTTGTAAGGAGAGG
JMFN006C07- TTTGAAGGAGAAGGAATCGAAGCTCAAGGCTGCTAGAATGAGTATCTTTGTAAGGAGAGG
rJMFF017B10+ TTTGAAGGAGAAGGAATCGAAGCTCAAGGCTGCTAGAATGAGTATCTTTGTAAGGAGAGG
rJMSF026D16+ TTTGAAGGAGAAGGAATCGAAGCTCAAGGCTGCTAGAATGGGTATCTTTGTAAGGAGAGG
                      ____________________________________________________________
consensus TTTGAAGGAGAAGGAATCGAAGCTCAAGGCTGCTAGAATGAGTATCTTTGTAAGGAGAGG
 
. : . : . : . : . : . :
rJMFF027P06+ CGGTCCGAACTACCAAAGGGGTCTTGCTAAGATGAGAGCTCTTGGAGAGGAAATCGGCAT
JMFN006C07- CGGTCCGAACTACCAAAGGGGTCTTGCTAAGATGAGAGCTCTTGGAGAGGAAATCGGCAT
rJMFF017B10+ CGGTCCGAACTACCAAAGGGGTCTTGCTAAGATGAGAGCTCTTGGAGAGGAAATCGGCAT
rJMSF026D16+ CGGTCCGAACTACCAAAGGGGTCTTGCTAAGATGAGAGCTCTTGGAGAGGAAATCGGCAT
                      ____________________________________________________________
consensus CGGTCCGAACTACCAAAGGGGTCTTGCTAAGATGAGAGCTCTTGGAGAGGAAATCGGCAT
 
. : . : . : . : . : . :
rJMFF027P06+ CCCCATTGAGGTCTACGGCCCGGAGGCAACCATGACAGGCATTTGCAAGCAGGCAATTGA
JMFN006C07- CCCCATTGAGGTCTACGGCCCGGAGGCAACCATGACAGGCATTTGCAAGCAGGCAATTGA
rJMFF017B10+ CCCCATTGAGGTCTACGGCCCGGAGGCAACCATGACAGGCATTTGCAAGCAGGCAATTGA
rJMSF026D16+ CCCCATTGAGGTCTACGGCCCGGAGGCAACCATGACAGGCATTTGCAAGCAGGCAATTGA
                      ____________________________________________________________
consensus CCCCATTGAGGTCTACGGCCCGGAGGCAACCATGACAGGCATTTGCAAGCAGGCAATTGA
 
. : . : . : . : . : . :
rJMFF027P06+ ATGCATCACTGCAGCTGCATAAAGAGCAAAGCAACTAATGCAACTCTGATTTCTATTTTA
JMFN006C07- ATGCATCACTGCAGCTGCATAAAGAGCAAAGCAACTAATGCAACTCTGATTTCTATTTTA
rJMFF017B10+ ATGCATCACTGCAGCTGCATAAAGAGCAAAGCAACTAATGCAACTCTGATTTCTATTTTA
rJMSF026D16+ ATGCATCACTGCAGCTGCATAAAGAGCAAAGCAACTAATGCAACTCTGATTTCTATTTTA
                      ____________________________________________________________
consensus ATGCATCACTGCAGCTGCATAAAGAGCAAAGCAACTAATGCAACTCTGATTTCTATTTTA
 
. : . : . : . : . : . :
rJMFF027P06+ TTCACTTCCTTCCTTTTTGGTTGTGTTTAGATGTCTGTTATAGCAATGTTGTGCCTCTTT
JMFN006C07- TTCACTTCCTTCCTTTTTGGTTGTGTTTAGATGTCTGTTATAGCAATGTTGTGCCTCTTT
rJMFF017B10+ TTCACTTCCTTCCTTTTTGGTTGTGTTTAGATGTCTGTTATAGCAATGTTGTGCCTCTTT
rJMSF026D16+ TTCACTTCCTTCCTTTTTGGTTGTGTTTAGATGTCTGTTATAGCAATGTTGTGCCTCTTT
                      ____________________________________________________________
consensus TTCACTTCCTTCCTTTTTGGTTGTGTTTAGATGTCTGTTATAGCAATGTTGTGCCTCTTT
 
. : . : . : . : . : . :
rJMFF027P06+ TGTTTGTATTTTTGACATTTCCATATAAATGGCCCATTTGAATTGGGCTCGAGCTGCAGC
JMFN006C07- TGTTTGTATTTTTGACATTTCCATATAAATGGCCCATTTGAATTGGG
rJMFF017B10+ TGTTTGTATTTTTGACATTTCCATATAAATGGCCCATTTGAATTGGGCTCGAGCTGCAGC
rJMSF026D16+ TGTTTGTATTTTTGACATTTCCATATAAATGGCCCATTTGAATTGGGCTCGAGCTGCAGC
                      ____________________________________________________________
consensus TGTTTGTATTTTTGACATTTCCATATAAATGGCCCATTTGAATTGGGCTCGAGCTGCAGC
 
. : . : . : . : . : . :
rJMFF027P06+ TATGAATCAATCACT
rJMFF017B10+ TATGAATCAATCACT
rJMSF026D16+ TATGAATCAATCACTTCCTTTATTTTGTGGGATTTTTCTTCTTTAATAACTTTGTAGCAT
                      ____________________________________________________________
consensus TATGAATCAATCACTTCCTTTATTTTGTGGGATTTTTCTTCTTTAATAACTTTGTAGCAT