Previous Contig 012451:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017P02Sequence616006160 (7)gb:AP001312_18211654e-55Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.785012451 (7)gb:AP003437_18294162e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFF022H23Sequence501006160 (7)gb:AP001312_18211653e-41Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.773012451 (7)gb:AP003437_18294163e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMFF027D05Sequence555006160 (7)gb:AP001312_18211651e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.609012451 (7)gb:AP003437_18294162e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF010A13Sequence215006160 (7)678012451 (7)gb:AP003437_18294167e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF020P05Sequence649006160 (7)gb:AP001312_18211652e-60Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.789012451 (7)gb:AP003437_18294162e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF023J21Sequence662006160 (7)gb:AP001312_18211651e-54Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.735012451 (7)gb:AP003437_18294161e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067
JMSF026A02Sequence630006160 (7)gb:AP001312_18211652e-42Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MYF5.730012451 (7)gb:AP003437_18294163e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023J21+ GGCA
                      ____________________________________________________________
consensus GGCA
 
. : . : . : . : . : . :
rJMSF023J21+ TCAACAAGGAAATGCAGTTCAGTTAAATGTGTAGAGGTCAACAAAGAATCAAAGCATTCT
rJMSF020P05+ AATGCAGNTCAGTTAAATGTGTAGA-GTCACCAANGAATCAAAGCNTTCT
                      ____________________________________________________________
consensus TCAACAAGGAAATGCAGTTCAGTTAAATGTGTAGAGGTCACCAAAGAATCAAAGCATTCT
 
. : . : . : . : . : . :
rJMSF023J21+ TTTACAAAGACAGCTGAGCGCTTGCCAACCAATCTTGATAGCAGCATTAGCTGGCATCAT
rJMSF020P05+ TTTACAAAGACAGCTGAGCGCTTGCCAACCAATCTTGATAGCAGCATTAGCTGGCATCAT
rJMFF022H23+ CTGAGCGCTTGCCAACCAATCTTGATAGCAGCATTAGCTGGCATCAT
rJMFF017P02+ CAAAGACAGCTGAGCGCTTGCCAACCAATCTTGATAGCAGCATTAGCTGGCATCAT
                      ____________________________________________________________
consensus TTTACAAAGACAGCTGAGCGCTTGCCAACCAATCTTGATAGCAGCATTAGCTGGCATCAT
 
. : . : . : . : . : . :
rJMSF023J21+ GCAGACACTTCAATTGAACCACTTTCTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
rJMSF020P05+ GCAGACACTTCAATTGAACCACTTTCTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
rJMSF010A13+ CTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
rJMFF022H23+ GCAGACACTTCAATTGAACCACTTTCTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
rJMFF017P02+ GCAGACACTTCAATTGAACCACTTTCTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
                      ____________________________________________________________
consensus GCAGACACTTCAATTGAACCACTTTCTTGGCTTGTTGGATCTGATGTTGTTGTGGTTGAC
 
. : . : . : . : . : . :
rJMSF023J21+ CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
rJMSF020P05+ CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
rJMSF010A13+ CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
rJMFF027D05+ TGATTAAGGCATTACAGACTGNGTCATACAAA
rJMFF022H23+ CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
rJMFF017P02+ CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
                      ____________________________________________________________
consensus CCTCCGAGGAAGGGACTGGATCCATCTCTGATTAAGGCATTACAGACTGTGTCATACAAA
 
. : . : . : . : . : . :
rJMSF023J21+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
rJMSF020P05+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
rJMSF010A13+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
rJMFF027D05+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACNTTGGGTTCTACGT
rJMFF022H23+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
rJMFF017P02+ AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
rJMSF026A02+ AGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
                      ____________________________________________________________
consensus AGCAAAAAATCTGAGAGTAATGAAAAGGCAAAAGATGAAAAAAGACCTTGGGTTCTACGT
 
. : . : . : . : . : . :
rJMSF023J21+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMSF020P05+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMSF010A13+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMFF027D05+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMFF022H23+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMFF017P02+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
rJMSF026A02+ GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
                      ____________________________________________________________
consensus GCAAGAGAAGCTTCAGTTCTGATTAGAGAGAAAACTGAGTATGAGGAAAACCAATCTTTG
 
. : . : . : . : . : . :
rJMSF023J21+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMSF020P05+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMSF010A13+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMFF027D05+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMFF022H23+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMFF017P02+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
rJMSF026A02+ CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
                      ____________________________________________________________
consensus CCTCAAACTCTCATCTATATAAGTTGTGGATGGGAAAGTTTTAAAGAGGATTGCATGTCA
 
. : . : . : . : . : . :
rJMSF023J21+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
rJMSF020P05+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCATGA
rJMSF010A13+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
rJMFF027D05+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
rJMFF022H23+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
rJMFF017P02+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
rJMSF026A02+ CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
                      ____________________________________________________________
consensus CTTGTGTCTTCCAAGGCATGGCATTTATCAAAGGCCCATGGCTTTAATTTCTTCCCAGGA
 
. : . : . : . : . : . :
rJMSF023J21+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMSF020P05+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMSF010A13+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMFF027D05+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMFF022H23+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMFF017P02+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
rJMSF026A02+ ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
                      ____________________________________________________________
consensus ACACAAAGTGTTGAGATTCTAGCCGTGTTTAAGAGAGGCTCAAGGGATAGCACTAAAAAG
 
. : . : . : . : . : . :
rJMSF023J21+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMSF020P05+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMSF010A13+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMFF027D05+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMFF022H23+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMFF017P02+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
rJMSF026A02+ AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGGGCATTTGGTAATTGGTAT
                      ____________________________________________________________
consensus AAGAAATTGGGAAAGAAGAAGAAGAATAGGCCTTCTTGAGGAGCATTTGGTAATTGGTAT
 
. : . : . : . : . : . :
rJMSF023J21+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
rJMSF020P05+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
rJMSF010A13+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
rJMFF027D05+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
rJMFF022H23+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
rJMFF017P02+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTNGGAAA
rJMSF026A02+ TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
                      ____________________________________________________________
consensus TTTAAGCAAGCAACAGAATTGGTACGGAGTATTATGCAGAAGAAGCAAATGCTTGGGAAA
 
. : . : . : . : . : . :
rJMSF023J21+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
rJMSF020P05+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
rJMSF010A13+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCGCT
rJMFF027D05+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
rJMFF022H23+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
rJMFF017P02+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
rJMSF026A02+ CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
                      ____________________________________________________________
consensus CTTCTGAAAAACTCAACATTTGTACGTGTAAATGTGTAATACTTCTGTCATTTTTGCACT
 
. : . : . : . : . : . :
rJMSF023J21+ ACATAAAATTA
rJMSF020P05+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
rJMSF010A13+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAACC
rJMFF027D05+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
rJMFF022H23+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
rJMFF017P02+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
rJMSF026A02+ ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
                      ____________________________________________________________
consensus ACATAAAATTATCAATGTAGAATGAAAAAATGACATGAAATACTTACGTTATACACAA-C
 
. : . : . : . : . : . :
rJMSF020P05+ AAAGTGTAAGAATATCCAC
rJMSF010A13+ AAAGTGTAAGAATATCCAC-TAGTCTTGCACAACCAGACCATTC
rJMFF027D05+ AAAGTG-AAGAATATCCACGTAGTCTTGCACAACCAGAC
rJMFF022H23+ AAAGTG-AAGAATATCCAC-TAGTCTTGCACAACCAGACCATTCTGTGTAAATATTATTT
rJMFF017P02+ AAAGTG-AAGAATATCCAC-TAGTCTTGCACAACCAGACCATTCTGTGTAAATATTATTT
rJMSF026A02+ AAAGTGTAAGAATATCCAC-TAGTCTTGCACAACCAGACCATTCTGTGTAAATATTATTT
                      ____________________________________________________________
consensus AAAGTGTAAGAATATCCAC-TAGTCTTGCACAACCAGACCATTCTGTGTAAATATTATTT
 
. : . : . : . : . : . :
rJMFF022H23+ T
rJMFF017P02+ T
rJMSF026A02+ TTAGAACAATAGTGACAATTGTTGAAACACAAAAGTTGTGTCTGTAGAAATATAGCTGTT
                      ____________________________________________________________
consensus TTAGAACAATAGTGACAATTGTTGAAACACAAAAGTTGTGTCTGTAGAAATATAGCTGTT
 
. : . : . : . : . : . :
rJMSF026A02+ GAAGTTGTGTAGGGTTGTGTCAATAGGATTGTATCTCTTAATTTGTATATATTTCTCTGT
                      ____________________________________________________________
consensus GAAGTTGTGTAGGGTTGTGTCAATAGGATTGTATCTCTTAATTTGTATATATTTCTCTGT