Previous Contig 012445:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025O21Sequence266003514 (2)762012445 (2)gb:AC121365_17402020.003Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0053E05, complet
JMSF040N13Sequence652020079gb:AP003253_18263791e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045815012445 (2)gb:AC121365_17402024e-25Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0053E05, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040N13+ TTTGCCAGTCATGCAATTTGGTAACCA
                      ____________________________________________________________
consensus TTTGCCAGTCATGCAATTTGGTAACCA
 
. : . : . : . : . : . :
rJMSF040N13+ GCACCCTGGTGGCATTGGAGTTCCTGCTGTTGGCATGGCATTTCCAGGTTATGTGGCTCA
                      ____________________________________________________________
consensus GCACCCTGGTGGCATTGGAGTTCCTGCTGTTGGCATGGCATTTCCAGGTTATGTGGCTCA
 
. : . : . : . : . : . :
rJMSF040N13+ GCCGCAACTTGGATTAGGGAGTTCCGAGATGACTTGGTTGCCTGTTTTAGCTGGTGCTGC
                      ____________________________________________________________
consensus GCCGCAACTTGGATTAGGGAGTTCCGAGATGACTTGGTTGCCTGTTTTAGCTGGTGCTGC
 
. : . : . : . : . : . :
rJMSF040N13+ TGGAGCATTGGGGGCTACGTATTGCTCACCCTATATTGCTGTTGATGGTGCCTATCATGG
rJMSF025O21+ GTATTGCTCACCCTATATTGCTGTNGATGGTGCCTATCATGG
                      ____________________________________________________________
consensus TGGAGCATTGGGGGCTACGTATTGCTCACCCTATATTGCTGTTGATGGTGCCTATCATGG
 
. : . : . : . : . : . :
rJMSF040N13+ TCGTCCATCTGGGCAGATTTCTACCCTCACCGCTGCTTCAAGCAAAGAAAATAATAGCAG
rJMSF025O21+ TCGTCCATCTGGGCAGATTTCTACCCTCACCGCTGCTTCAAGCAAAGAAAATAATAGCAG
                      ____________________________________________________________
consensus TCGTCCATCTGGGCAGATTTCTACCCTCACCGCTGCTTCAAGCAAAGAAAATAATAGCAG
 
. : . : . : . : . : . :
rJMSF040N13+ CAAACCTAATAATGAAGGGAAGCCTTCGCAAAAGCCTGAACTTGGAAATGATGACTTTGG
rJMSF025O21+ CAAACCTAATAATGAAGGGAAGCCTTCGCAAAAGCCTGAACTTGGAAATGATGACTTTGG
                      ____________________________________________________________
consensus CAAACCTAATAATGAAGGGAAGCCTTCGCAAAAGCCTGAACTTGGAAATGATGACTTTGG
 
. : . : . : . : . : . :
rJMSF040N13+ GCAGCGACAGAAGAATCCTCGCAGATATACAGAGATGAAGTTTGACCAATGAAGTAGTGG
rJMSF025O21+ GCAGCGACAGAAGAATCCTCGCAGATATACAGAGATGAAGTTTGACCAATGAAGTAGTGG
                      ____________________________________________________________
consensus GCAGCGACAGAAGAATCCTCGCAGATATACAGAGATGAAGTTTGACCAATGAAGTAGTGG
 
. : . : . : . : . : . :
rJMSF040N13+ TGTATGTTGAACCTGTTTGAATAAGCCGGTTAATATCAAATTATCCAATTAAAATCTTCC
rJMSF025O21+ TGTATGTTGAACCTGTTTGAATAAGCCGGTTAATATCAAATTATCCAATTAAAATCTTCC
                      ____________________________________________________________
consensus TGTATGTTGAACCTGTTTGAATAAGCCGGTTAATATCAAATTATCCAATTAAAATCTTCC
 
. : . : . : . : . : . :
rJMSF040N13+ ATCTTTAGTTGGGTGTTGCATTCTGTGTGGTACTTTCAGTGCTGCAGGCCTTTTCCCGGG
rJMSF025O21+ ATCTTTAGTTGGGTGTTGCATTCTGTGTGGTACTTTCAGTGCTGCAGGCCTTTTCCCGGG
                      ____________________________________________________________
consensus ATCTTTAGTTGGGTGTTGCATTCTGTGTGGTACTTTCAGTGCTGCAGGCCTTTTCCCGGG
 
. : . : . : . : . : . :
rJMSF040N13+ CCCTTCTCCATTTGTAGATCTGGAGAACCTGGGGCTCTCATGTATTCTGCCTTACCTTAG
rJMSF025O21+ CCCTTCTCCATTTGTAGATCTGGAGAACCTGGGGCTCTCATGTATTCTGCCTTACCTTAG
                      ____________________________________________________________
consensus CCCTTCTCCATTTGTAGATCTGGAGAACCTGGGGCTCTCATGTATTCTGCCTTACCTTAG
 
. : . : . : . : . : . :
rJMSF040N13+ GTTTACATGACAAAACGCCTGCTCATGCTGCTTCACTTCAGGAGCTACACTGCAGCTTGA
rJMSF025O21+ GTTTACATGACAAAACGCCTGCTCATGCTGCTTCACTTCAGGAGCTACACTGCAGCTTGA
                      ____________________________________________________________
consensus GTTTACATGACAAAACGCCTGCTCATGCTGCTTCACTTCAGGAGCTACACTGCAGCTTGA
 
. : . : . : . : . : . :
rJMSF040N13+ CGGGTGGCAGTTCTTTACTCAATATGT-GTTCTTGTGGCTTGCTTTTGTTTCAATGAGGC
rJMSF025O21+ CGGGTGGCAGTTCTTTACTCAATATGTGGTTCTTGTGGCTTGCTTTTGTTTCAATGAGGC
                      ____________________________________________________________
consensus CGGGTGGCAGTTCTTTACTCAATATGTGGTTCTTGTGGCTTGCTTTTGTTTCAATGAGGC
 
. : . : . : . : . : . :
rJMSF040N13+ TTGTGAGAATAGTTACTGGACTTCTAGAAGATGATAAATAATGGCAAAGAACAAGAGGCA
rJMSF025O21+ TTGTGAGAATAGTTACTGGACTTCTAGAAGATGATAAATAATGGCAAAGAACAAGAGGCA
                      ____________________________________________________________
consensus TTGTGAGAATAGTTACTGGACTTCTAGAAGATGATAAATAATGGCAAAGAACAAGAGGCA
 
. : . : . : . : . : . :
rJMSF040N13+ TTATGTAGCAGAAGTATGTTATGCTAAGTTCATATATTTCCAGTATATGGTTTTGTTTAC
rJMSF025O21+ TTATGTAGCAGAAGTATGTTATGCTAAGTTCATATATTTCCAGTATATGGTTTTGTTTAC
                      ____________________________________________________________
consensus TTATGTAGCAGAAGTATGTTATGCTAAGTTCATATATTTCCAGTATATGGTTTTGTTTAC
 
. : . : . : . : . : . :
rJMSF040N13+ AAATCTGGT
rJMSF025O21+ AAATCTGGTTTGCGTCAAAATTCCGTGGATAATGTTACCCTTTTGAGGAGGATGCTGCCT
                      ____________________________________________________________
consensus AAATCTGGTTTGCGTCAAAATTCCGTGGATAATGTTACCCTTTTGAGGAGGATGCTGCCT
 
. : . : . : . : . : . :
rJMSF025O21+ TGTGTATTTTACATTTACTTGATGGAAACACTGCTTTTGGTCAGATTTGTATTTTGCATT
                      ____________________________________________________________
consensus TGTGTATTTTACATTTACTTGATGGAAACACTGCTTTTGGTCAGATTTGTATTTTGCATT