Previous Contig 012437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041B05Sequence569012437 (3)
JMFS049H12Sequence604012437 (3)
JMSF025M17Sequence689006327 (3)793012437 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041B05+ TAATTGCAGACCAATCGATTTCTGCCCTTTCGTTAACT
JMFS049H12+ CTTTCCAAAGTAATTAATTGCAGACCAATCGATTTCTGCCCTTTCGTTAACT
rJMSF025M17- CCCTTTCGTT-ACT
                      ____________________________________________________________
consensus CTTTCCAAAGTAATTAATTGCAGACCAATCGATTTCTGCCCTTTCGTTAACT
 
. : . : . : . : . : . :
JMFN041B05+ AACGATAGGGAAGCAATTCTATCTAAATCTCTATATATACATCACTTTCTCTTCAATGCA
JMFS049H12+ AACGATAGGGAAGCAATTCTATCTAAATCTCTATATATACATCACTTTCTCTTCAATGCA
rJMSF025M17- AACGATAGGGAAGCAATTCTATCTAAATCTCTATATATACATCACTTTCTCTTCAATGCA
                      ____________________________________________________________
consensus AACGATAGGGAAGCAATTCTATCTAAATCTCTATATATACATCACTTTCTCTTCAATGCA
 
. : . : . : . : . : . :
JMFN041B05+ AAGACTATCAAGTTTCAGTCTTCAATACAAATACTAGGTCATGCAGGCCAGCAGTTATAC
JMFS049H12+ AAGACTATCAAGTTTCAGTCTTCAATACAAATACTAGGTCATGCAGGCCAGCAGTTATAC
rJMSF025M17- AAGACTATCAAGTTTCAGTCTTCAATACAAATACTAGGTCATGCAGGCCAGCAGTTATAC
                      ____________________________________________________________
consensus AAGACTATCAAGTTTCAGTCTTCAATACAAATACTAGGTCATGCAGGCCAGCAGTTATAC
 
. : . : . : . : . : . :
JMFN041B05+ CAGAAGTCTCGCCGGAAACGGAGCAGCGTCGAATTATACCTGAAGCCTCGCCGAAAAGGG
JMFS049H12+ CAGAAGTCTCGCCGGAAACGGAGCAGCGTCGAATTATACCTGAAGCCTCGCCGAAAAGGG
rJMSF025M17- CAGAAGTCTCGCCGGAAACGGAGCAGCGTCGAATTATACCTGAAGCCTCGCCGAAAAGGG
                      ____________________________________________________________
consensus CAGAAGTCTCGCCGGAAACGGAGCAGCGTCGAATTATACCTGAAGCCTCGCCGAAAAGGG
 
. : . : . : . : . : . :
JMFN041B05+ ATCAGCCGAATTATACCTGAAGCCTCGCCGAAAAGGGATCAGCGTCGAATTAGAGCCTAC
JMFS049H12+ ATCAGCCGAATTATACCTGAAGCCTCGCCGAAAAGGGATCAGCGTCGAATTAGAGCCTAC
rJMSF025M17- ATCAGCCGAATTATACCTGAAGCCTCGCCGAAAAGGGATCAGCGTCGAATTAGAGCCTAC
                      ____________________________________________________________
consensus ATCAGCCGAATTATACCTGAAGCCTCGCCGAAAAGGGATCAGCGTCGAATTAGAGCCTAC
 
. : . : . : . : . : . :
JMFN041B05+ CAGCAGGGAAAACGTCCAATATCTACTCCACAGCCGTAGCCAAAGCACATGGAAGTGGAA
JMFS049H12+ CAGCAGGGAAAACGTCCAATATCTACTCCACAGCCGTAGCCAAAGCACATGGAAGTGGAA
rJMSF025M17- CAGCAGGGAAAACGTCCAATATCTACTCCACAGCCGTAGCCAAAGCACATGGAAGTGGAA
                      ____________________________________________________________
consensus CAGCAGGGAAAACGTCCAATATCTACTCCACAGCCGTAGCCAAAGCACATGGAAGTGGAA
 
. : . : . : . : . : . :
JMFN041B05+ CTTCTTTGCCAAAACCTTCTTGGGCTGTCAAAACATTACCACCAATGTGTATTATATGTC
JMFS049H12+ CTTCTTTGCCAAAACCTTCTTGGGCTGTCAAAACATTACCACCAATGTGTATTATATGTC
rJMSF025M17- CTTCTTTGCCAAAACCTTCTTGGGCTGTCAAAACATTACCACCAATGTGTATTATATGTC
                      ____________________________________________________________
consensus CTTCTTTGCCAAAACCTTCTTGGGCTGTCAAAACATTACCACCAATGTGTATTATATGTC
 
. : . : . : . : . : . :
JMFN041B05+ TGTTACACATAGAATACATTACCACCAATGTGTATTCTCTGTCTCTTAGACAAATTTGAA
JMFS049H12+ TGTTACACATAGAATACATTACCACCAATGTGTATTCTCTGTCTCTTAGACAAATTTGAA
rJMSF025M17- TGTTACACATAGAATACATTACCACCAATGTGTATTCTCTGTCTCTTAGACAAATTTGAA
                      ____________________________________________________________
consensus TGTTACACATAGAATACATTACCACCAATGTGTATTCTCTGTCTCTTAGACAAATTTGAA
 
. : . : . : . : . : . :
JMFN041B05+ CATC
JMFS049H12+ CATC
rJMSF025M17- CATCTCTGTGGGATTCCCACTGTTAAGTTTGGGGCATATTTTATTCGAAATCATCAACAG
                      ____________________________________________________________
consensus CATCTCTGTGGGATTCCCACTGTTAAGTTTGGGGCATATTTTATTCGAAATCATCAACAG
 
. : . : . : . : . : . :
rJMSF025M17- GCATATTTTATTCGAAATCATCAACCTCAACAGCTTGGCTCATATTGCAGTGGTAGAGAT
                      ____________________________________________________________
consensus GCATATTTTATTCGAAATCATCAACCTCAACAGCTTGGCTCATATTGCAGTGGTAGAGAT
 
. : . : . : . : . : . :
rJMSF025M17- TATTAGTTTTTATTTGATGCCCCAATTTACGAGATGCCCTGCAAAAAAATAAATATTTAG
                      ____________________________________________________________
consensus TATTAGTTTTTATTTGATGCCCCAATTTACGAGATGCCCTGCAAAAAAATAAATATTTAG
 
. : . : . : . : . : . :
rJMSF025M17- TGTTTTCAAATAAAGGAAAACTCATATACTTATTCAAATTGGCAACTAAATCAGTTTTTA
                      ____________________________________________________________
consensus TGTTTTCAAATAAAGGAAAACTCATATACTTATTCAAATTGGCAACTAAATCAGTTTTTA
 
. : . : . : . : . : . :
rJMSF025M17- AATAACTGGGACATGTTATAAAAATTTAAGCATAATTGCATACACTTTTTCTTATTAATG
                      ____________________________________________________________
consensus AATAACTGGGACATGTTATAAAAATTTAAGCATAATTGCATACACTTTTTCTTATTAATG
 
. : . : . : . : . : . :
rJMSF025M17- TGTACTTAAATTGGCTTATACATGTTCTAAAAAAAATAGAATTAGAAAAAGNGATTACCA
                      ____________________________________________________________
consensus TGTACTTAAATTGGCTTATACATGTTCTAAAAAAAATAGAATTAGAAAAAGNGATTACCA